Ribozyme-type gene expression regulation element and application thereof
A technology for regulating elements and gene expression, applied in the field of genetic engineering, can solve the problems of less gene regulation, insufficient regulation of gene expression, and insufficient inhibition of the active conformation of ribozymes, and achieve the effect of effective regulation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0022] Embodiment 1, the design of ribozyme type gene expression control element of the present invention
[0023] The nucleotide sequence of the ribozyme-type gene expression regulatory element designed by the present invention is shown in SEQ ID NO.1, which includes a hammerhead ribozyme (Sm ribozyme) from Schistosoma mansoni and a specificity The artificial aptamer (Theo-aptamer) that recognizes theophylline, and the aptamer is connected to the stem III of the hammerhead ribozyme; this regulatory element can be formed after the target gene is transcribed into RNA in the cell figure 1 The two conformations shown are A conformation and B conformation (according to the RNA secondary structure prediction software RNAstructure 5.6); figure 1 Middle: A is the conformation of the ribozyme when no ligand is bound; B is the conformation of the ribozyme after binding the ligand; 1 is the Sm ribozyme; 2 is theophylline aptamer; 3 is the spacer sequence), and the ribozyme structure , ...
Embodiment 2
[0030] Embodiment 2, comparison with the ON type ribozyme regulatory system reported in the literature
[0031] There are very few ON-type ribozyme regulatory systems that have been proven effective in mammalian cells. L2Bulge8 and L2Bulge9 are two ribozyme regulatory systems that can be used in mammalian cells reported by Win et al. The ligand is also theophylline, but the ribozyme is sTRSV hammerhead ribozyme from tobacco ringspot virus.
[0032] Shanghai Sangon Biotechnology Co., Ltd. was commissioned to synthesize the above-mentioned existing L2Bulge8, L2Bulge9 and sTRSV ribozyme sequences, and insert them into the 3'UTR of the hRluc gene through the restriction sites XhoI and PmeI. Also with empty vector (psiCHECK TM -2) as a control, the results after luciferase analysis are as follows image 3 shown.
[0033] The pure sTRSV ribozyme represents the largest inhibitory ability of the target gene among all ribozymes tested, from image 3It can be seen that when the liga...
Embodiment 3
[0035] Example 3, the curative effect of ribozyme-type gene expression regulatory elements of the present invention on gene expression regulation
[0036] The non-coding region has a major impact on the transcription and translation of mRNA. The insertion of foreign sequences may change the expression level of the gene. In order to exclude the non-specific effect of the ribozyme sequence itself on gene expression, a more accurate assessment of ribozyme cleavage For the regulatory effect of gene expression, we designed the ribozyme inactivation sequence SmTheoMN shown in SEQ ID NO.6, specifically: AAACAAACAAACTGAGGTGCAGGTACATCCAGCTGACGAGTCCCAAATAGGACGA G AAGCTATACCAGCCGAAAGGCCCTTGGCAGAGCTAGCTTCCTGGATTCCACTGCTATCCAAAAAAAAAAAAAAAAA, the mutation site is located at the 56th nucleotide (underlined), which is on the conserved sequence of the ribozyme. After the mutation, the ribozyme will lose its cleavage ability, but according to RNAstrure5.6, it has the same sequence as SmTheo Se...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 