Unlock instant, AI-driven research and patent intelligence for your innovation.

Ribozyme-type gene expression regulation element and application thereof

A technology for regulating elements and gene expression, applied in the field of genetic engineering, can solve the problems of less gene regulation, insufficient regulation of gene expression, and insufficient inhibition of the active conformation of ribozymes, and achieve the effect of effective regulation

Active Publication Date: 2015-07-22
华桥生物工程科技有限公司
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although a large number of ligand-dependent ribozymes have been screened or designed, very few of them can be used for gene regulation in mammalian cells, especially ON-type regulation (that is, gene expression increases with the increase of ligand concentration). and the ON-type ribozyme gene expression regulatory elements reported in the current literature all connect the aptamer to the stem II of the hammerhead ribozyme, but because the stem II is extremely important for the intracellular cleavage activity of the hammerhead ribozyme, The insertion of the aptamer sequence is not conducive to the formation of the active conformation of the ribozyme; in the absence of a ligand, the ribozyme cannot fully form an active conformation, resulting in leakage of gene expression; in the presence of a ligand, the active conformation of the ribozyme cannot be fully inhibited , which reduces the gene expression efficiency; therefore, the gene expression regulation of the current ON-type ribozyme-type gene expression regulatory elements is not rigorous enough, that is, there are more leaky expressions of the target gene when the ligand concentration is 0
Some people also linked the aptamer to the stem III of the hammerhead ribozyme, but all obtained were OFF-type gene expression regulatory elements

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Ribozyme-type gene expression regulation element and application thereof
  • Ribozyme-type gene expression regulation element and application thereof
  • Ribozyme-type gene expression regulation element and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] Embodiment 1, the design of ribozyme type gene expression control element of the present invention

[0023] The nucleotide sequence of the ribozyme-type gene expression regulatory element designed by the present invention is shown in SEQ ID NO.1, which includes a hammerhead ribozyme (Sm ribozyme) from Schistosoma mansoni and a specificity The artificial aptamer (Theo-aptamer) that recognizes theophylline, and the aptamer is connected to the stem III of the hammerhead ribozyme; this regulatory element can be formed after the target gene is transcribed into RNA in the cell figure 1 The two conformations shown are A conformation and B conformation (according to the RNA secondary structure prediction software RNAstructure 5.6); figure 1 Middle: A is the conformation of the ribozyme when no ligand is bound; B is the conformation of the ribozyme after binding the ligand; 1 is the Sm ribozyme; 2 is theophylline aptamer; 3 is the spacer sequence), and the ribozyme structure , ...

Embodiment 2

[0030] Embodiment 2, comparison with the ON type ribozyme regulatory system reported in the literature

[0031] There are very few ON-type ribozyme regulatory systems that have been proven effective in mammalian cells. L2Bulge8 and L2Bulge9 are two ribozyme regulatory systems that can be used in mammalian cells reported by Win et al. The ligand is also theophylline, but the ribozyme is sTRSV hammerhead ribozyme from tobacco ringspot virus.

[0032] Shanghai Sangon Biotechnology Co., Ltd. was commissioned to synthesize the above-mentioned existing L2Bulge8, L2Bulge9 and sTRSV ribozyme sequences, and insert them into the 3'UTR of the hRluc gene through the restriction sites XhoI and PmeI. Also with empty vector (psiCHECK TM -2) as a control, the results after luciferase analysis are as follows image 3 shown.

[0033] The pure sTRSV ribozyme represents the largest inhibitory ability of the target gene among all ribozymes tested, from image 3It can be seen that when the liga...

Embodiment 3

[0035] Example 3, the curative effect of ribozyme-type gene expression regulatory elements of the present invention on gene expression regulation

[0036] The non-coding region has a major impact on the transcription and translation of mRNA. The insertion of foreign sequences may change the expression level of the gene. In order to exclude the non-specific effect of the ribozyme sequence itself on gene expression, a more accurate assessment of ribozyme cleavage For the regulatory effect of gene expression, we designed the ribozyme inactivation sequence SmTheoMN shown in SEQ ID NO.6, specifically: AAACAAACAAACTGAGGTGCAGGTACATCCAGCTGACGAGTCCCAAATAGGACGA G AAGCTATACCAGCCGAAAGGCCCTTGGCAGAGCTAGCTTCCTGGATTCCACTGCTATCCAAAAAAAAAAAAAAAAA, the mutation site is located at the 56th nucleotide (underlined), which is on the conserved sequence of the ribozyme. After the mutation, the ribozyme will lose its cleavage ability, but according to RNAstrure5.6, it has the same sequence as SmTheo Se...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a ribozyme-type gene expression regulation element with a nucleotide sequence as shown in SEQ ID NO:1 and discloses a ribozyme-mediated gene regulation system built by utilizing the regulation element. Specifically, the nucleotide sequence of the ribozyme-type gene expression regulation element is inserted in a non-coding region of a destination gene, and theophylline is added into a culture medium of a host cell after the destination gene is transferred into the host cell, so that the expression level of the destination gene is improved along with increment of theophylline concentration. The regulation element disclosed by the invention is short, small and exquisite, and can show ON-type regulation performance in various eukaryotic cells; moreover, the built gene regulation system can conveniently and effectively regulate gene expression, so that a platform can be expanded for the fields of gene treatment, gene function research and the like.

Description

【Technical field】 [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a ribozyme-type gene expression regulation element and the construction of a ribozyme-mediated gene regulation system by using it. 【Background technique】 [0002] By controlling the transcription of DNA to mRNA or the translation of mRNA to protein, the expression level of genes can be effectively regulated. At present, the most commonly used gene regulation systems are based on transcription control, that is, the use of exogenous ligands to control the combination of protein trans-acting factors and promoters to initiate or inhibit the transcription process, such as tetracycline transcription switches, etc., the volume of such regulatory systems It is huge, requires specialized promoters and trans-acting factors, and is immunotoxic to the host, making it difficult to meet the needs of various fields such as gene therapy and gene function research. In r...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/85
Inventor 王佳稳刁勇
Owner 华桥生物工程科技有限公司