Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Gene detection method of Leber's hereditary optic neuropathy, (LHON) gene chip and kit

A technology of optic neuropathy and gene chip, applied in the direction of biochemical equipment and methods, microbial measurement/inspection, etc., can solve the problems of strict PCR amplification conditions and increase of false negatives, etc.

Active Publication Date: 2015-07-29
ZHEJIANG UNIV
View PDF4 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although this method can detect positive sites in a short period of time, the PCR amplification conditions are strict, and the probability of false negatives is greatly increased

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene detection method of Leber's hereditary optic neuropathy, (LHON) gene chip and kit
  • Gene detection method of Leber's hereditary optic neuropathy, (LHON) gene chip and kit
  • Gene detection method of Leber's hereditary optic neuropathy, (LHON) gene chip and kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Embodiment 1 A kit of the present invention

[0046] see figure 1, The chip kit provided by the present invention is composed of three components: a solid-phase chip for optic neuropathy gene SNP detection, probe components required for multiplex PCR, hybridization solution and eluent components of the kit. Among them, the solid-phase chip for optic neuropathy gene SNP detection includes a solid-phase carrier and a detection probe (21 bases) immobilized on the solid-phase carrier, wherein the solid-phase carrier can be made of silicon chips or glass slides (but not limited to The above materials), the surface is modified with amino or aldehyde groups; the probe components required for multiplex PCR include multiplex PCR primers: sample forward primer 1: ACAGGGTTTGTTAAGATGGC AGA (ID: SEQ118), reverse primer 1: GACTAGTTCGGACTCCCC TTC G( ID: SEQ119); forward primer 2: CCCCTTCGCCCTATTCTTCAT (ID: SEQ120), reverse primer 2: GGTGCCTTGGGTAACCTCTG G (ID: SEQ121); forward prime...

Embodiment 2

[0047] Example 2 Detection of Hereditary Optic Neuropathy Families Carrying Mitochondrial DNA Mutations

[0048] 1. Test samples

[0049] Select 5 typical hereditary optic neuropathy families EP1, EP2, EP3, EP4, EP5. See the figure below for his family pedigree. This family presents a typical maternal inheritance, and the only clinical symptom of the patients is vision loss, but the degree of visual impairment of each affected member in the family varies.

[0050] 2. Chip Fabrication and Analysis

[0051] (1) Amplification and purification of labeled samples: Multiplex PCR amplification was performed on DNA extracted from clinical samples, and Cy3-dCTP or Cy5-dCTP was introduced into the amplification to obtain target gene fragments as described in Table 1; prepared in the following system Reaction system: 5X Phusion Buffer: 5uL, Template (50ng / uL) 1uL, Primer Mix (19uM) 1uL, 10mMdNTP Mix (Cy3-dCTP:dCTP=1:10) 0.5uL, Phusion High-Fidelity DNAPolymerase (2U / uL) 0.25uL, 17.25...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a gene detection method of Leber's hereditary optic neuropathy, (LHON), a gene chip and a kit. The kit comprises a plurality of PCR probes and primers for detecting SNP of optic nerve lesion genes. The chip is provided with detection probes aiming at 13 mitochondrial genes and 46 SNP loci. According to the gene detection method, the kit and the gene chip are utilized to perform detection, the gene detection method comprises the following steps: performing amplification and hybridization on marked samples; scanning hybridization signals; obtaining chip data, and processing the obtained chip data; judging SNP loci, and judging and reading SNP loci information of the visual lesion genes. The gene detection method disclosed by the invention overcomes the detects that by adopting the direct sequencing, the using sample volume is large and the blood sample quantity is large, the amplification time is long, the amplification frequency is high, and false positive or false negative results can be easily caused, and the like, so that the pain of detected persons can be relieved, and not only be the detection accuracy improved, but also the detection time is shortened. According to the invention, the chip and the kit which have the characteristics of being rapid and being high in flux are provided, so that the early diagnosis and treatment of diseases can be facilitated, and nationwide large-scale screening and preventive inspection are convenient to carry out.

Description

technical field [0001] The invention belongs to the field of life science and biotechnology, and in particular relates to a solid-phase chip, a probe and a related detection kit for hereditary optic neuropathy gene SNP detection. The present invention mainly provides: (1) providing a gene SNP detection chip for hereditary optic nerve disease, which includes 117 probe series for 46 SNP sites of 13 mitochondrial genes; (2) providing a detection chip for SNP sites Preparation of probe primers; (3) providing a kit for SNP detection of ophthalmic disease-related genes; (4) providing a more comprehensive method for detecting SNP sites of hereditary optic neuropathy genes. Background technique [0002] Leber's Hereditary Optic Neuropathy (Leber's Hereditary Optic Neuropathy, LHON, referred to as Leber's disease) is a maternal hereditary optic neuropathy, mainly involving the retina, the anterior part of the scleral cribriform plate macular bundle fibers, leading to maternal genetic...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
CPCC12Q1/6883C12Q2600/156C12Q2600/16
Inventor 管敏鑫蒋萍萍冀延春郎秋雷张娟娟梁敏
Owner ZHEJIANG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com