Gene detection method of Leber's hereditary optic neuropathy, (LHON) gene chip and kit
A technology of optic neuropathy and gene chip, applied in the direction of biochemical equipment and methods, microbial measurement/inspection, etc., can solve the problems of strict PCR amplification conditions and increase of false negatives, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0045] Embodiment 1 A kit of the present invention
[0046] see figure 1, The chip kit provided by the present invention is composed of three components: a solid-phase chip for optic neuropathy gene SNP detection, probe components required for multiplex PCR, hybridization solution and eluent components of the kit. Among them, the solid-phase chip for optic neuropathy gene SNP detection includes a solid-phase carrier and a detection probe (21 bases) immobilized on the solid-phase carrier, wherein the solid-phase carrier can be made of silicon chips or glass slides (but not limited to The above materials), the surface is modified with amino or aldehyde groups; the probe components required for multiplex PCR include multiplex PCR primers: sample forward primer 1: ACAGGGTTTGTTAAGATGGC AGA (ID: SEQ118), reverse primer 1: GACTAGTTCGGACTCCCC TTC G( ID: SEQ119); forward primer 2: CCCCTTCGCCCTATTCTTCAT (ID: SEQ120), reverse primer 2: GGTGCCTTGGGTAACCTCTG G (ID: SEQ121); forward prime...
Embodiment 2
[0047] Example 2 Detection of Hereditary Optic Neuropathy Families Carrying Mitochondrial DNA Mutations
[0048] 1. Test samples
[0049] Select 5 typical hereditary optic neuropathy families EP1, EP2, EP3, EP4, EP5. See the figure below for his family pedigree. This family presents a typical maternal inheritance, and the only clinical symptom of the patients is vision loss, but the degree of visual impairment of each affected member in the family varies.
[0050] 2. Chip Fabrication and Analysis
[0051] (1) Amplification and purification of labeled samples: Multiplex PCR amplification was performed on DNA extracted from clinical samples, and Cy3-dCTP or Cy5-dCTP was introduced into the amplification to obtain target gene fragments as described in Table 1; prepared in the following system Reaction system: 5X Phusion Buffer: 5uL, Template (50ng / uL) 1uL, Primer Mix (19uM) 1uL, 10mMdNTP Mix (Cy3-dCTP:dCTP=1:10) 0.5uL, Phusion High-Fidelity DNAPolymerase (2U / uL) 0.25uL, 17.25...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
