A micro-rna family that modulates fibrosis and uses thereof

A technique for tissue fibrosis, application in developmental biology and molecular biology, capable of solving complex problems

Active Publication Date: 2015-11-11
BOARD OF RGT THE UNIV OF TEXAS SYST
View PDF45 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

While a growing number of esoteric computational methods for predicting miRNAs and their targets are available, target prediction remains a major challenge and requires experimental validation
Attributing miRNA function to regulation of specific mRNA targets is further complicated by the ability of each miRNA to base-pair with hundreds of potential high- and low-affinity mRNA targets and the ability of multiple miRNAs to target each mRNA

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A micro-rna family that modulates fibrosis and uses thereof
  • A micro-rna family that modulates fibrosis and uses thereof
  • A micro-rna family that modulates fibrosis and uses thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0394] Example 1: Regulation of Cardiac Hypertrophy and Heart Failure by Pressure Responsive miRNAs

[0395] Based on their involvement in regulating cellular phenotypes, the inventors hypothesized that miRNAs play a role in regulating the cardiac response to cardiac stress, which is known to result in transcriptional and translational changes in gene expression. To investigate the possible involvement of miRNAs in cardiac hypertrophy, they performed a side-by-side miRNA Microarray analysis. Mice (TAB) (Hill et al., 2000) subjected to thoracic aortic bandage (which induces hypertrophy by increasing cardiac afterload) were compared with sham-operated animals. In a second model, transgenic mice (Molkentin et al., 1998) expressing activated calcineurin (CnA) in the heart (which leads to a severe, characterized form of hypertrophy) were compared with wild-type littermates A comparison was made (FIG. 14A). RNA isolated from hearts of TAB mice showed elevated expression of 27 miR...

Embodiment 2

[0397] Example 2: Discovery of the miR-29 family as downstream targets of miR-208 regulation

[0398] In an effort to identify downstream miRNAs that might mediate the effects of miR-208, the inventors performed miRNA microarrays on hearts from wild-type and miR-208-null mice ( Figure 16 ). They found that multiple members of the miR-29 family were upregulated in miR-208 null mice ( Figure 17 ). Target predictions indicate that miR-29 family members target mRNAs encoding various collagens and other components of the extracellular matrix ( Figure 18 ). Thus, upregulation of miR-29 family members in miR-208-null mice may account for the blockade of fibrosis seen in these animals ( Figure 19 ).

[0399] The discovery that miR-29a-c is downregulated and targets mRNAs encoding collagen and extracellular matrix proteins in diseased hearts suggests that strategies to enhance miR-29a-c expression or its binding to target mRNAs may contribute to pathological cardiac remodeling...

Embodiment 3

[0400] Example 3: miR-29a-c regulates the expression of fibrotic genes

[0401] To begin to define the possible functions of miR-29a-c in the post-MI heart, the inventors used computational predictions to identify possible targets of miR-29a-c. The Targetscan predictions web site points to an unexpectedly high number of fibrosis-associated mRNAs encoding collagens, metallopeptidases, and integrins as possible miR-29a-c targets (web site at targetscan.org). To determine whether miR-29a-c downregulation might regulate cardiac fibrosis, the inventors focused on predicted targets involved in ECM generation in the heart. Elastin (ELN), fibrillin 1 (FBN1), collagen types I α1 and α2 (COL1A1, COL1A2), and collagen type III α1 (COL3A1) all contain one or more conserved potential seeds of miR-29a-c sequence (FIG. 20A).

[0402]Because miRNAs downregulate the steady-state levels of their target mRNAs as well as translation, the inventors analyzed the expression of predicted miR-29a-cm...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

598702 Disclosed is the use of an antisense oligonucleotide for preparation of a medicament for treating pathologies or deficiencies that are characterized by a loss, lack, or underproduction of collagen, wherein the antisense oligonucleotide comprises a sequence that is at least partially complementary to a miR-29a (uagcaccaucugaaaucggu), miR-29b (uagcaccauuugaaaucagu), or miR-29c (uagcaccauuugaaaucggu) sequence. Further disclosed is the use of an antisense oligonucleotide for preparation of a medicament for increasing collagen deposition in a tissue for treatment of natural aging and stretch marks. Further disclosed is a composition formulated for topical administration comprising a pharmaceutically acceptable carrier and an antisense oligonucleotide comprising a sequence that is at least partially complementary to a miR-29a, miR-29b, and / or miR-29c sequence.

Description

[0001] This application is a divisional application of an invention application with a filing date of July 31, 2008, a Chinese application number of 200880109703.0, and an invention title of "MicroRNA family regulating fibrosis and its use". [0002] Cross References to Related Applications [0003] This application claims U.S. Provisional Application No. 60 / 952,917, filed July 31, 2007; U.S. Provisional Application No. 60 / 980,303, filed October 16, 2007; and U.S. Provisional Application No. .61 / 047,014, which are incorporated herein in their entirety by reference. [0004] Statement Regarding Government Funding [0005] This invention was made with support from Grant No. HL53351-06 from the National Institutes of Health (NIH). The government has certain rights in this invention. [0006] Instructions for Electronically Submitted Text Files [0007] The contents of the text file accompanying this electronic submission are incorporated in its entirety by reference: Computer-r...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K31/7088A61P9/00A61P17/00A61P21/00A61P1/16A61P13/12A61P11/00A61P3/10
Inventor埃里克.奥尔森伊娃.范鲁伊杰
OwnerBOARD OF RGT THE UNIV OF TEXAS SYST