211 results about "Stretch marks" patented technology

I have discovered cosmetic or topical pharmaceutical compositions for external body part or organ slimming, firming, cellulite reduction, fat-reduction, and obesity control benefits that are in synergistic combination with benefits for the treatment of skin aging, skin wrinkles reduction, skin exfoliating, treatment of acne, treatment of rosacea, age-spots reduction, skin surface whitening, skin surface brightening striae distensae (stretch marks) reduction, treatment of pimples, treatment of skin infections and lesions, spider veins reduction, blood microcirculation (venous insufficiency) improvement, UVA / UVB protection of skin, and skin redness reduction. These compositions thus provide multiple combinations of skin and external body part or organ enhancement benefits that can be selective and specific for external body parts and organs such as face, chin, cheeks, arms, "love handles" in abdomen area, eye lids and eye zone, neck, breasts, thighs, and hips. These compositions include a body beneficial composition selected from certain nutraceutical, cosmetic, and pharmaceutical ingredients, a composition to promote collagen and elastin synthesis in the skin, and a cosmetically or pharmaceutically acceptable delivery system.

Methods and systems for treating stretch marks through deep tissue tightening with ultrasound are provided. An exemplary method and system comprise a therapeutic ultrasound system configured for providing ultrasound treatment to a shallow tissue region, such as a region comprising an epidermis, a dermis and a deep dermis. In accordance with various exemplary embodiments, a therapeutic ultrasound system can be configured to achieve depth from 0 mm to 1 cm with a conformal selective deposition of ultrasound energy without damaging an intervening tissue in the range of frequencies from 2 to 50 MHz. In addition, a therapeutic ultrasound can also be configured in combination with ultrasound imaging or imaging / monitoring capabilities, either separately configured with imaging, therapy and monitoring systems or any level of integration thereof.

Methods and systems for treating stretch marks through deep tissue tightening with ultrasound are provided. An exemplary method and system comprise a therapeutic ultrasound system configured for providing ultrasound treatment to a shallow tissue region, such as a region comprising an epidermis, a dermis and a deep dermis. In accordance with various exemplary embodiments, a therapeutic ultrasound system can be configured to achieve depth from 0 mm to 1 cm with a conformal selective deposition of ultrasound energy without damaging an intervening tissue in the range of frequencies from 2 to 50 MHz. In addition, a therapeutic ultrasound can also be configured in combination with ultrasound imaging or imaging / monitoring capabilities, either separately configured with imaging, therapy and monitoring systems or any level of integration thereof.

Embodiments of a dermatological cosmetic treatment and imaging system and method can include use of transducer and a reflective surface to simultaneously produce multiple cosmetic treatment zones in tissue. The system can include a hand wand, a removable transducer module, a control module, a graphical user interface and / or a parabolic reflector. In some embodiments, the cosmetic treatment system may be used in cosmetic procedures, including brow lifts, fat reduction, sweat reduction, and treatment of the décolletage. Skin tightening, lifting and amelioration of wrinkles and stretch marks are provided.

Pharmaceutical, personal care and cosmetic compositions containing a tripeptide and a tetrapeptide are useful for treating visible signs of aging including wrinkles, stretch marks and dark circles.

This invention relates to in-situ preparation of the derivatives of various hydroxy acids (HA), such as alpha-(Alpha) Hydroxy Acids (AHA), beta-(Beta) Hydroxy Acids (BHA), and Poly-Hydroxy Acids (PHA) with certain skin beneficial organic hetero-atom bases and their application in skin resurfacing (exfoliation), and in the synergistic treatment and regulation of topical disorders of skin such as skin aging, wrinkles, acne, rosacea, age-spots, canker sores, striae distensae (stretch marks), pimples, skin redness, and dry skin conditions of cracking, flaking, and scaling. Most HA derivatives produced by the in-situ method do not cause skin irritation and skin redness effects that are commonly experienced with AHA and BHA, yet there is no loss of their skin beneficial effects. These compositions can be traditional water and oil emulsions, liposomes, suspensions, colloids, solutions, masks, muds, serums, sprays, gels, lotions, creams, cleansers, and anhydrous systems, thus offering a wide choice of formulations to meet their consumer appeal and acceptance requirements.

The disclosure provides a method and apparatus for noninvasive and minimally-invasive treatment of skin and subcutaneous tissues with ultrasound with or without nano- or microparticles. The treatment includes, but is not limited to, hair removal, skin rejuvenation (wrinkle removal), scar removal, treatment of spider veins and varicose veins, removal of birthmarks, acne treatment, wound treatment, abnormal pigmentation and stretch mark removal, abnormal tissues in skin and subcutaneous layers, and tattoo removal. Skin and subcutaneous tissues which can be treated with the methods described include, but are not limited to, the dermis, epidermis, subcutaneous fat, connective tissue, muscle tissue, blood vessels, scar tissues, tendons, and cartilage tissues, and abnormal tissues in skin and subcutaneous layers. The disclosure is especially applicable to hair removal and skin rejuvenation.

Certain embodiments here in are directed to a method of treating a tissue associated with a defect in a human including wrinkles, rhytids, depressed scar, cutaneous depressions, stretch marks, hyperplasia of the lip, nasolabial fold, melolabial fold, scarring from acne vulgaris, and post-rhinoplasty irregularity. The tissue defect may be treated by introducing a plurality of in vitro cultured autologous fibroblast cells at or proximal to the defect area of the patient's tissue. The autologous fibroblast cells may have been cultured in vitro to expand the number of fibroblast cells in at least one medium that comprises autologous serum. The autologous fibroblast cell cultures may be derived from connective tissue, dermal, fascial fibroblasts, papillary fibroblasts, and / or reticular fibroblasts.

Embodiments of a dermatological cosmetic treatment and imaging system and method can include use of transducer to simultaneously or substantially simultaneously produce multiple cosmetic treatment zones in tissue. The system can include a hand wand, a removable transducer module, a control module, and / or graphical user interface. In some embodiments, the cosmetic treatment system may be used in cosmetic procedures, including brow lifts, fat reduction, sweat reduction, and treatment of the décolletage. Skin tightening, lifting and amelioration of wrinkles and stretch marks are provided.

Device, methods, and compositions to alter light interplay with skin to change appearance of wrinkles, pigmentation, stretch marks, and cellulite as well as other skin conditions are described. The present invention relates generally to the treatment of soft tissue volume deficiency and loss, facial wrinkles, facial lines, pigmentation patterns not desired by the subject, stretch marks, cellulite and more particularly, to treatments for volume restoration or coloration correction using light reflective materials such as micas and the like.

A method and system for skin tightening comprises a hollow cannula that contains an optical fiber connected to a laser source. The cannula is inserted subcutaneously into a patient so that the end of the fiber is located within the tissue underlying the dermis. The source emits an output pulse that is conveyed by the fiber to the dermis, where the pulse causes collagen destruction and shrinkage within the treatment area. Radiation from the skin surface is detected to prevent non-reversible damage to the dermis, such as skin necrosis and excessive collagen melting. This method of sub-cutaneous laser treatment can also be used to treat striae, or stretch marks.

Embodiments of a dermatological cosmetic treatment and / or imaging system and method can include use of transducer to create a linear thermal treatment zone at a focal depth to form a band shaped treatment area. The system can include one or more ultrasound transducers, a cylindrical transduction element, an imaging element, a hand wand, a removable transducer module, a control module, and / or graphical user interface. In some embodiments, a coated transducer may be used to provide more consistent treatment in cosmetic procedures, including brow lifts, fat reduction, sweat reduction, and treatment of the décolletage. Skin tightening, lifting and amelioration of wrinkles and stretch marks are provided. Treatment may include heating of tissue for a duration to deactivate a percentage of cells in the treatment region.

The present invention relates to a composition comprising panthenol, a collagen synthesis stimulating peptide and an anti-inflammatory extract. The compositions are particular useful for preventing and treating stretch marks.

Methods and systems for treating stretch marks through deep tissue tightening with ultrasound are provided. An exemplary method and system comprise a therapeutic ultrasound system configured for providing ultrasound treatment to a shallow tissue region, such as a region comprising an epidermis, a dermis and a deep dermis. In accordance with various exemplary embodiments, a therapeutic ultrasound system can be configured to achieve depth from 0 mm to 1 cm with a conformal selective deposition of ultrasound energy without damaging an intervening tissue in the range of frequencies from 2 to 50 MHz. In addition, a therapeutic ultrasound can also be configured in combination with ultrasound imaging or imaging / monitoring capabilities, either separately configured with imaging, therapy and monitoring systems or any level of integration thereof.

The invention relates to the stimulation of the activity of an isoform of lysyl oxidase, and more particularly of the LOX (lysyl oxidase) isoform. The invention relates notably to a screening method of an active principle which regulates elastogenesis in cases of pathological, disorganized and / or non-functional elastogenesis, as in cases of fibrosis, of solar elastosis, of stretch marks, and / or of dystrophic scars; and / or in cases of some eczematous pathologies. The aim of the invention is mainly to provide such a screening method so as to provide compositions enabling the elastogenesis in the cases cited to be regulated.

The invention relates to a novel agent containing fat (oil), which contains onion extract, in addition to the production and use thereof for caring, preventing or treating damaged skin tissue, such as after operations, biopsies, wounds, burns and other accidents, and especially scarred tissue, stretch marks, degenerative skin conditions and others. The agent is characterised in that the base thereof is based on oil, which can be used to produce, for example, cream, lotion, fluid, massage, or balm based products which contain fail (oil). Surprisingly, the onion extract, which contains water, alcohol or water-alcohol, can be integrated into a base containing oil without the effectiveness thereof being reduced or a phase separation being produced. The effectiveness thereof could be proved when the medical application thereof was monitored.

Pharmaceutical, personal care and cosmetic compositions containing a tripeptide and a tetrapeptide are useful for treating visible signs of aging including wrinkles, stretch marks and dark circles.

The present invention discloses certain di- and polyvalent metal zeolite compounds (formula I) for topical delivery of biological and skin and hair care agents. The method of treating skin and hair condition via topical application of said zeolite compounds is also disclosed. The said method provides a treatment for topical condition, which includes alleviation of skin conditions such as skin rash including diaper rash, dry skin, scalp dandruff, broken or chafed skin, sunburn, skin damage from UV, skin irritation, acne including excess facial oil and facial pore size; darkened skin including age spots, dark circles around the eyes, and discoloration of skin from stretch marks; skin aging including wrinkles and fine lines; loss of collagen including thinning skin and loss of skin pliability; body odor, including oral cavity odor, arm-pit odor, and incontinence odor; cellular inflammation including intracellular and extra cellular inflammation; premature hair aging including premature hair loss hair graying; malfunction of tyrosinase group of enzymes, malfunction of matrix metalloprotease group of enzymes; and combinations thereof. The said method also provides topical delivery of certain metals, including trace metals, and certain zirconium aluminum amino acids that provide antiperspirant benefits;

Embodiments of a dermatological cosmetic treatment and imaging system and method can include use of transducer to simultaneously or substantially simultaneously produce multiple cosmetic treatment zones in tissue. The system can include a hand wand, a removable transducer module, a control module, and / or graphical user interface. In some embodiments, the cosmetic treatment system may be used in cosmetic procedures, including brow lifts, fat reduction, sweat reduction, and treatment of the décolletage. Skin tightening, lifting and amelioration of wrinkles and stretch marks are provided.

The invention discloses a stretch mark removing, scar repairing, wrinkle removing and whitening skin care product which comprises a sovereign drug, a ministerial drug, an adjuvant drug and a conductant drug. The sovereign drug comprises oligopeptides and cannabidiol, the ministerial drug comprises amino carboxyglucan sodium and sodium hyaluronate, the adjuvant drug comprises olive essential oil, vitamin E, almond extracting solution, dandelion extracting solution, purslane extracting solution, white atractylodes rhizome extracting solution, pseudo-ginseng freeze-dried powder, tuckahoe extracting solution, common bletilla tuber extracting solution and coix seed extracting solution, and the conductant drug comprises licorice root extracting solution and deionized water. Compared with the prior art, the skin care product has the advantages of excellent removing and repairing effects on skin attractiveness, aging and cuticles caused by stretch marks, various scars and wrinkles.

Compounds of general formula (I): their stereoisomers, mixtures thereof and / or their cosmetically or pharmaceutically acceptable salts, cosmetic and / or pharmaceutical compositions which contain them and their use in medicine, and in the treatment and / or care of the skin, particularly in the aging and photoaging of the skin, and more particularly for the treatment and / or prevention of wrinkles and / or stretch marks.

Stretch mark prevention undergarments (1) worn around a woman's abdomen, chest, lower torso, legs, buttocks and other areas for reinforcing elastic fibers in the skin and preventing stretch marks. The stretch mark prevention undergarment has an outer layer (2) made of stretchable material and an inner layer (8) of webbed material made of a non-slip material (9). The non-slip material maintains a constant adherent traction with the skin of a wearer, thereby reinforcing elastic fibers of skin. The inner layer is arranged in a webbed “fishnet” or other design to allow a wearer's skin to breath through the outer layer of the stretch mark prevention undergarment. The stretch mark prevention undergarment may be in the form of underwear (14), briefs, underpants, panties, leggings (16), corsets, bras (10) or any combination thereof to help prevent stretch marks on various parts of the body.

This invention relates to a novel method of reducing the appearance of rhytides (“facial wrinkles”) and / or infra-orbital shadows (“dark circles”) under the eyes, and striae (“stretch marks”), or lentigo senilis (“age spots”), and hyper / hypo pigmentation on other anatomical areas. Particularly, this invention relates to a topical patch worn on the skin that in a preferred embodiment incorporates two distinct layers, each providing useful features and together providing a novel article and method of improving skin cosmesis. Ease of use, patient comfort and cost effectiveness are provided. The patch is applied to the affected area and preferably worn at least several hours and more preferably worn overnight. The product increases the hydration level of the skin over which it is applied. There is a slight increase to the volume of the local superficial tissue, which serves to tighten the overlying skin and reduce the size and quantity of fine wrinkles at least temporarily. Various active ingredients, such as peptides, vitamin compounds, antioxidants, growth factors, glycolic or alphahydroxy acids, etc., may be incorporated into the present invention thereby providing an enhanced effect or other perceived advantage in the market.

598702 Disclosed is the use of an antisense oligonucleotide for preparation of a medicament for treating pathologies or deficiencies that are characterized by a loss, lack, or underproduction of collagen, wherein the antisense oligonucleotide comprises a sequence that is at least partially complementary to a miR-29a (uagcaccaucugaaaucggu), miR-29b (uagcaccauuugaaaucagu), or miR-29c (uagcaccauuugaaaucggu) sequence. Further disclosed is the use of an antisense oligonucleotide for preparation of a medicament for increasing collagen deposition in a tissue for treatment of natural aging and stretch marks. Further disclosed is a composition formulated for topical administration comprising a pharmaceutically acceptable carrier and an antisense oligonucleotide comprising a sequence that is at least partially complementary to a miR-29a, miR-29b, and / or miR-29c sequence.

The invention provides a gynecological nursing bed, comprising a bed body including a bed frame and a bed plate; two sides of the top of the bed frame are provided with slide channels, two sides of the lower surface of the bed plate are provided with elongated sliders corresponding to the slide channels, the bed plate includes a front plate and a rear plate, the front plate is hinged to the rear plate, an end of the front plate is provided with a height adjusting mechanism connected with the bed frame, a modular massage mechanism is arranged on the bed frame through a translation mechanism, the lateral side of the bed frame is provided with a box, a medicine application mechanism is movably arranged in the box, a liquid medicine drying mechanism is arranged on the bed frame, a controller that controls the translation mechanism, the modular massage mechanism and the liquid medicine drying mechanism is arranged below the bed frame, and a crib is arranged on one side of the bed frame. Thegynecological nursing bed can provide antenatal nursing for a pregnant woman to relieve physical discomfort due to pregnancy, can massage legs to relieve pain, can apply moisturizing medicine to thebelly to prevent and treat stretch marks, and has great benefit to the physical and mental health of the pregnant woman.

The invention relates to a barrel stretch forming process capable of manufacturing a barrel by using a round stock and the barrel manufactured by the process. The barrel stretch forming process comprises the following the steps: supply the round stock; continuously carrying out one-time positive stretch and one-time negative stretch for the round stock in sequence. The barrel achieves the effect of the smooth outer surface and cannot generate stretch marks or a bubbling phenomenon. The barrel stretch forming process continuously carries out one-time positive stretch and one-time negative stretch for the round stock in sequence, so that the forming of the barrel can be completed, and the traditional three steps of stretch procedures is not needed. Moreover, material feeding and internal stress are uniform in the positive and negative stretch processes, the crystal structure is good, the outer surface is smooth, and the stretch marks or the bubbling phenomenon cannot occur. The manufacturing procedure is reduced, the use of corollary equipment is reduced, the cost of labor resources is reduced, the reject rate is lowered, and the production cost is reduced.

The present invention relates to novel dressings containing polysulfated oligosaccharides and having the controlled release of said active ingredients. The invention also relates to a method for preparing same, wherein the method comprises a treatment step using ethylene oxide. The invention also relates to the uses thereof for caring for wounds and for treating and / or preventing scars and stretch marks.

The invention relates to a Chinese medicament paste for treating stretch marks of pregnant women. The stretch marks mostly appear in the 15th week of a pregnancy. As bellies bulge, the stretch marks become obvious, mostly appear in the bellies, thighs, buttocks, waists, shoulders, arms and the like, can not be eliminated, exist in the whole life of patients and cause skin laxity and wrinkles which influence the appearance and health of the patients. The patients can not casually take the medicaments on the market, because once the medicaments are taken improperly, the patients and fetuses in uteruses of the patients are harmed. The Chinese medicament paste is prepared from Chinese medicaments, so that the Chinese medicament paste does not have side effects or irritation, and can achieve a good treatment effect.