Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

204 results about "Skin striae" patented technology

"Striae" is also a general term referring to thin, narrow grooves or channels, or a thin line or band especially if several of them are parallel or close together. Stretch marks, also known as striae, are a form of scarring on the skin with an off-color hue.

Topical Nutraceutical Compositions with Selective Body Slimming and Tone Firming Antiaging Benefits

I have discovered cosmetic or topical pharmaceutical compositions for external body part or organ slimming, firming, cellulite reduction, fat-reduction, and obesity control benefits that are in synergistic combination with benefits for the treatment of skin aging, skin wrinkles reduction, skin exfoliating, treatment of acne, treatment of rosacea, age-spots reduction, skin surface whitening, skin surface brightening striae distensae (stretch marks) reduction, treatment of pimples, treatment of skin infections and lesions, spider veins reduction, blood microcirculation (venous insufficiency) improvement, UVA / UVB protection of skin, and skin redness reduction. These compositions thus provide multiple combinations of skin and external body part or organ enhancement benefits that can be selective and specific for external body parts and organs such as face, chin, cheeks, arms, "love handles" in abdomen area, eye lids and eye zone, neck, breasts, thighs, and hips. These compositions include a body beneficial composition selected from certain nutraceutical, cosmetic, and pharmaceutical ingredients, a composition to promote collagen and elastin synthesis in the skin, and a cosmetically or pharmaceutically acceptable delivery system.
Owner:GUPTA SHYAM K

Method and system for treating stretch marks

Methods and systems for treating stretch marks through deep tissue tightening with ultrasound are provided. An exemplary method and system comprise a therapeutic ultrasound system configured for providing ultrasound treatment to a shallow tissue region, such as a region comprising an epidermis, a dermis and a deep dermis. In accordance with various exemplary embodiments, a therapeutic ultrasound system can be configured to achieve depth from 0 mm to 1 cm with a conformal selective deposition of ultrasound energy without damaging an intervening tissue in the range of frequencies from 2 to 50 MHz. In addition, a therapeutic ultrasound can also be configured in combination with ultrasound imaging or imaging / monitoring capabilities, either separately configured with imaging, therapy and monitoring systems or any level of integration thereof.
Owner:GUIDED THERAPY SYSTEMS LLC

Method and system for treating stretch marks

Methods and systems for treating stretch marks through deep tissue tightening with ultrasound are provided. An exemplary method and system comprise a therapeutic ultrasound system configured for providing ultrasound treatment to a shallow tissue region, such as a region comprising an epidermis, a dermis and a deep dermis. In accordance with various exemplary embodiments, a therapeutic ultrasound system can be configured to achieve depth from 0 mm to 1 cm with a conformal selective deposition of ultrasound energy without damaging an intervening tissue in the range of frequencies from 2 to 50 MHz. In addition, a therapeutic ultrasound can also be configured in combination with ultrasound imaging or imaging / monitoring capabilities, either separately configured with imaging, therapy and monitoring systems or any level of integration thereof.
Owner:GUIDED THERAPY SYSTEMS LLC

Reflective ultrasound technology for dermatological treatments

Embodiments of a dermatological cosmetic treatment and imaging system and method can include use of transducer and a reflective surface to simultaneously produce multiple cosmetic treatment zones in tissue. The system can include a hand wand, a removable transducer module, a control module, a graphical user interface and / or a parabolic reflector. In some embodiments, the cosmetic treatment system may be used in cosmetic procedures, including brow lifts, fat reduction, sweat reduction, and treatment of the décolletage. Skin tightening, lifting and amelioration of wrinkles and stretch marks are provided.
Owner:GUIDED THERAPY SYSTEMS LLC

Compositions containing mixtures of tetrapeptides and tripeptides

Pharmaceutical, personal care and cosmetic compositions containing a tripeptide and a tetrapeptide are useful for treating visible signs of aging including wrinkles, stretch marks and dark circles.
Owner:SEDERMA SA

Hydroxy acids based delivery systems for skin resurfacing and anti-aging compositions

This invention relates to in-situ preparation of the derivatives of various hydroxy acids (HA), such as alpha-(Alpha) Hydroxy Acids (AHA), beta-(Beta) Hydroxy Acids (BHA), and Poly-Hydroxy Acids (PHA) with certain skin beneficial organic hetero-atom bases and their application in skin resurfacing (exfoliation), and in the synergistic treatment and regulation of topical disorders of skin such as skin aging, wrinkles, acne, rosacea, age-spots, canker sores, striae distensae (stretch marks), pimples, skin redness, and dry skin conditions of cracking, flaking, and scaling. Most HA derivatives produced by the in-situ method do not cause skin irritation and skin redness effects that are commonly experienced with AHA and BHA, yet there is no loss of their skin beneficial effects. These compositions can be traditional water and oil emulsions, liposomes, suspensions, colloids, solutions, masks, muds, serums, sprays, gels, lotions, creams, cleansers, and anhydrous systems, thus offering a wide choice of formulations to meet their consumer appeal and acceptance requirements.
Owner:GUPTA SHYAM K

Ultrasound-based treatment methods for therapeutic treatment of skin and subcutaneous tissues

InactiveUS20070078290A1Ultrasound therapySurgeryWrinkle skinAbnormal pigmentation
The disclosure provides a method and apparatus for noninvasive and minimally-invasive treatment of skin and subcutaneous tissues with ultrasound with or without nano- or microparticles. The treatment includes, but is not limited to, hair removal, skin rejuvenation (wrinkle removal), scar removal, treatment of spider veins and varicose veins, removal of birthmarks, acne treatment, wound treatment, abnormal pigmentation and stretch mark removal, abnormal tissues in skin and subcutaneous layers, and tattoo removal. Skin and subcutaneous tissues which can be treated with the methods described include, but are not limited to, the dermis, epidermis, subcutaneous fat, connective tissue, muscle tissue, blood vessels, scar tissues, tendons, and cartilage tissues, and abnormal tissues in skin and subcutaneous layers. The disclosure is especially applicable to hair removal and skin rejuvenation.
Owner:BOARD OF RGT THE UNIV OF TEXAS SYST

Tissue treatments with adipocyte cells

Certain embodiments here in are directed to a method of treating a tissue associated with a defect in a human including wrinkles, rhytids, depressed scar, cutaneous depressions, stretch marks, hyperplasia of the lip, nasolabial fold, melolabial fold, scarring from acne vulgaris, and post-rhinoplasty irregularity. The tissue defect may be treated by introducing a plurality of in vitro cultured autologous fibroblast cells at or proximal to the defect area of the patient's tissue. The autologous fibroblast cells may have been cultured in vitro to expand the number of fibroblast cells in at least one medium that comprises autologous serum. The autologous fibroblast cell cultures may be derived from connective tissue, dermal, fascial fibroblasts, papillary fibroblasts, and / or reticular fibroblasts.
Owner:KLEINSEK DON A

Devices and methods for multi-focus ultrasound therapy

Embodiments of a dermatological cosmetic treatment and imaging system and method can include use of transducer to simultaneously or substantially simultaneously produce multiple cosmetic treatment zones in tissue. The system can include a hand wand, a removable transducer module, a control module, and / or graphical user interface. In some embodiments, the cosmetic treatment system may be used in cosmetic procedures, including brow lifts, fat reduction, sweat reduction, and treatment of the décolletage. Skin tightening, lifting and amelioration of wrinkles and stretch marks are provided.
Owner:ULTHERA INC

Device, Methods and Compositions to Alter Light Interplay with Skin

Device, methods, and compositions to alter light interplay with skin to change appearance of wrinkles, pigmentation, stretch marks, and cellulite as well as other skin conditions are described. The present invention relates generally to the treatment of soft tissue volume deficiency and loss, facial wrinkles, facial lines, pigmentation patterns not desired by the subject, stretch marks, cellulite and more particularly, to treatments for volume restoration or coloration correction using light reflective materials such as micas and the like.
Owner:WAUGH JACOB M

Sub-dermal laser skin treatment

A method and system for skin tightening comprises a hollow cannula that contains an optical fiber connected to a laser source. The cannula is inserted subcutaneously into a patient so that the end of the fiber is located within the tissue underlying the dermis. The source emits an output pulse that is conveyed by the fiber to the dermis, where the pulse causes collagen destruction and shrinkage within the treatment area. Radiation from the skin surface is detected to prevent non-reversible damage to the dermis, such as skin necrosis and excessive collagen melting. This method of sub-cutaneous laser treatment can also be used to treat striae, or stretch marks.
Owner:EL EN SPA +1

Band transducer ultrasound therapy

InactiveUS20170028227A1Improved treatment of tissueAvoid damageUltrasound therapySurgeryWrinkly skinUltrasonic sensor
Embodiments of a dermatological cosmetic treatment and / or imaging system and method can include use of transducer to create a linear thermal treatment zone at a focal depth to form a band shaped treatment area. The system can include one or more ultrasound transducers, a cylindrical transduction element, an imaging element, a hand wand, a removable transducer module, a control module, and / or graphical user interface. In some embodiments, a coated transducer may be used to provide more consistent treatment in cosmetic procedures, including brow lifts, fat reduction, sweat reduction, and treatment of the décolletage. Skin tightening, lifting and amelioration of wrinkles and stretch marks are provided. Treatment may include heating of tissue for a duration to deactivate a percentage of cells in the treatment region.
Owner:ULTHERA INC

Novel compositions and their use

The present invention relates to a composition comprising panthenol, a collagen synthesis stimulating peptide and an anti-inflammatory extract. The compositions are particular useful for preventing and treating stretch marks.
Owner:DSM IP ASSETS BV

Method and system for ultrasound treatment of skin

Methods and systems for treating stretch marks through deep tissue tightening with ultrasound are provided. An exemplary method and system comprise a therapeutic ultrasound system configured for providing ultrasound treatment to a shallow tissue region, such as a region comprising an epidermis, a dermis and a deep dermis. In accordance with various exemplary embodiments, a therapeutic ultrasound system can be configured to achieve depth from 0 mm to 1 cm with a conformal selective deposition of ultrasound energy without damaging an intervening tissue in the range of frequencies from 2 to 50 MHz. In addition, a therapeutic ultrasound can also be configured in combination with ultrasound imaging or imaging / monitoring capabilities, either separately configured with imaging, therapy and monitoring systems or any level of integration thereof.
Owner:GUIDED THERAPY SYSTEMS LLC

Stimulation of the activity of an isoform of lysyl oxidase for combating against some pathologies due to an incomplete, absent or disorganized elastogenesis

The invention relates to the stimulation of the activity of an isoform of lysyl oxidase, and more particularly of the LOX (lysyl oxidase) isoform. The invention relates notably to a screening method of an active principle which regulates elastogenesis in cases of pathological, disorganized and / or non-functional elastogenesis, as in cases of fibrosis, of solar elastosis, of stretch marks, and / or of dystrophic scars; and / or in cases of some eczematous pathologies. The aim of the invention is mainly to provide such a screening method so as to provide compositions enabling the elastogenesis in the cases cited to be regulated.
Owner:CENT NAT DE LA RECHERCHE SCI +1

Agent containing fat (oil), which contains onion extract, the production and use thereof for caring, preventing or treating damaged skin tissue, especially scarred tissue

The invention relates to a novel agent containing fat (oil), which contains onion extract, in addition to the production and use thereof for caring, preventing or treating damaged skin tissue, such as after operations, biopsies, wounds, burns and other accidents, and especially scarred tissue, stretch marks, degenerative skin conditions and others. The agent is characterised in that the base thereof is based on oil, which can be used to produce, for example, cream, lotion, fluid, massage, or balm based products which contain fail (oil). Surprisingly, the onion extract, which contains water, alcohol or water-alcohol, can be integrated into a base containing oil without the effectiveness thereof being reduced or a phase separation being produced. The effectiveness thereof could be proved when the medical application thereof was monitored.
Owner:MERZ PHARMA GMBH & CO KGAA

Formula including tetrapeptide and tripeptide mixture

Pharmaceutical, personal care and cosmetic compositions containing a tripeptide and a tetrapeptide are useful for treating visible signs of aging including wrinkles, stretch marks and dark circles.
Owner:SEDERMA SA

Topical Delivery of Biological and Cosmetic Agents by Zeolites

The present invention discloses certain di- and polyvalent metal zeolite compounds (formula I) for topical delivery of biological and skin and hair care agents. The method of treating skin and hair condition via topical application of said zeolite compounds is also disclosed. The said method provides a treatment for topical condition, which includes alleviation of skin conditions such as skin rash including diaper rash, dry skin, scalp dandruff, broken or chafed skin, sunburn, skin damage from UV, skin irritation, acne including excess facial oil and facial pore size; darkened skin including age spots, dark circles around the eyes, and discoloration of skin from stretch marks; skin aging including wrinkles and fine lines; loss of collagen including thinning skin and loss of skin pliability; body odor, including oral cavity odor, arm-pit odor, and incontinence odor; cellular inflammation including intracellular and extra cellular inflammation; premature hair aging including premature hair loss hair graying; malfunction of tyrosinase group of enzymes, malfunction of matrix metalloprotease group of enzymes; and combinations thereof. The said method also provides topical delivery of certain metals, including trace metals, and certain zirconium aluminum amino acids that provide antiperspirant benefits;
Owner:BIODERM RES

Devices and methods for multi-focus ultrasound therapy

Embodiments of a dermatological cosmetic treatment and imaging system and method can include use of transducer to simultaneously or substantially simultaneously produce multiple cosmetic treatment zones in tissue. The system can include a hand wand, a removable transducer module, a control module, and / or graphical user interface. In some embodiments, the cosmetic treatment system may be used in cosmetic procedures, including brow lifts, fat reduction, sweat reduction, and treatment of the décolletage. Skin tightening, lifting and amelioration of wrinkles and stretch marks are provided.
Owner:ULTHERA INC

Stretch mark removing, scar repairing, wrinkle removing and whitening skin care product and preparation method thereof

The invention discloses a stretch mark removing, scar repairing, wrinkle removing and whitening skin care product which comprises a sovereign drug, a ministerial drug, an adjuvant drug and a conductant drug. The sovereign drug comprises oligopeptides and cannabidiol, the ministerial drug comprises amino carboxyglucan sodium and sodium hyaluronate, the adjuvant drug comprises olive essential oil, vitamin E, almond extracting solution, dandelion extracting solution, purslane extracting solution, white atractylodes rhizome extracting solution, pseudo-ginseng freeze-dried powder, tuckahoe extracting solution, common bletilla tuber extracting solution and coix seed extracting solution, and the conductant drug comprises licorice root extracting solution and deionized water. Compared with the prior art, the skin care product has the advantages of excellent removing and repairing effects on skin attractiveness, aging and cuticles caused by stretch marks, various scars and wrinkles.
Owner:李博

Stretch mark prevention undergarment

InactiveUS20110230119A1Inhibition formationPreventing stretch marksGirdlesCorsetsButtocksFiber
Stretch mark prevention undergarments (1) worn around a woman's abdomen, chest, lower torso, legs, buttocks and other areas for reinforcing elastic fibers in the skin and preventing stretch marks. The stretch mark prevention undergarment has an outer layer (2) made of stretchable material and an inner layer (8) of webbed material made of a non-slip material (9). The non-slip material maintains a constant adherent traction with the skin of a wearer, thereby reinforcing elastic fibers of skin. The inner layer is arranged in a webbed “fishnet” or other design to allow a wearer's skin to breath through the outer layer of the stretch mark prevention undergarment. The stretch mark prevention undergarment may be in the form of underwear (14), briefs, underpants, panties, leggings (16), corsets, bras (10) or any combination thereof to help prevent stretch marks on various parts of the body.
Owner:MATERNA DERMA +1

Wrinkle reducing skin patch, process of manufacture and useful articles thereof

This invention relates to a novel method of reducing the appearance of rhytides (“facial wrinkles”) and / or infra-orbital shadows (“dark circles”) under the eyes, and striae (“stretch marks”), or lentigo senilis (“age spots”), and hyper / hypo pigmentation on other anatomical areas. Particularly, this invention relates to a topical patch worn on the skin that in a preferred embodiment incorporates two distinct layers, each providing useful features and together providing a novel article and method of improving skin cosmesis. Ease of use, patient comfort and cost effectiveness are provided. The patch is applied to the affected area and preferably worn at least several hours and more preferably worn overnight. The product increases the hydration level of the skin over which it is applied. There is a slight increase to the volume of the local superficial tissue, which serves to tighten the overlying skin and reduce the size and quantity of fine wrinkles at least temporarily. Various active ingredients, such as peptides, vitamin compounds, antioxidants, growth factors, glycolic or alphahydroxy acids, etc., may be incorporated into the present invention thereby providing an enhanced effect or other perceived advantage in the market.
Owner:BIO MED SCI

A micro-rna family that modulates fibrosis and uses thereof

598702 Disclosed is the use of an antisense oligonucleotide for preparation of a medicament for treating pathologies or deficiencies that are characterized by a loss, lack, or underproduction of collagen, wherein the antisense oligonucleotide comprises a sequence that is at least partially complementary to a miR-29a (uagcaccaucugaaaucggu), miR-29b (uagcaccauuugaaaucagu), or miR-29c (uagcaccauuugaaaucggu) sequence. Further disclosed is the use of an antisense oligonucleotide for preparation of a medicament for increasing collagen deposition in a tissue for treatment of natural aging and stretch marks. Further disclosed is a composition formulated for topical administration comprising a pharmaceutically acceptable carrier and an antisense oligonucleotide comprising a sequence that is at least partially complementary to a miR-29a, miR-29b, and / or miR-29c sequence.
Owner:BOARD OF RGT THE UNIV OF TEXAS SYST

Gynecological nursing bed

The invention provides a gynecological nursing bed, comprising a bed body including a bed frame and a bed plate; two sides of the top of the bed frame are provided with slide channels, two sides of the lower surface of the bed plate are provided with elongated sliders corresponding to the slide channels, the bed plate includes a front plate and a rear plate, the front plate is hinged to the rear plate, an end of the front plate is provided with a height adjusting mechanism connected with the bed frame, a modular massage mechanism is arranged on the bed frame through a translation mechanism, the lateral side of the bed frame is provided with a box, a medicine application mechanism is movably arranged in the box, a liquid medicine drying mechanism is arranged on the bed frame, a controller that controls the translation mechanism, the modular massage mechanism and the liquid medicine drying mechanism is arranged below the bed frame, and a crib is arranged on one side of the bed frame. Thegynecological nursing bed can provide antenatal nursing for a pregnant woman to relieve physical discomfort due to pregnancy, can massage legs to relieve pain, can apply moisturizing medicine to thebelly to prevent and treat stretch marks, and has great benefit to the physical and mental health of the pregnant woman.
Owner:NANYANG MEDICAL COLLEGE

Peptides, compositions comprising them and uses in particular cosmetic uses

ActiveUS20170157014A1Improve appearance and general statePrevention of signCosmetic preparationsPeptide/protein ingredientsCell-Extracellular MatrixCollagen i
The peptides have the general following formula: X-Pro*-Pro*-Xaa-Y in which: —Xaa is selected from Leucine (Leu, L), Arginine (Arg, R), Lysine (Lys, K), Alanine (Ala, A), Serine (Ser, S), and Aspartic acid (Asp, D); —At the N terminal end of the peptide, X is selected from H, —CO—R1 and —SO2—R1; —At the C terminal end of the peptide, Y is selected from OH, OR1, NH2, NHR1 and NR1R2; —R1 and R2 are, independently from each other, selected from an alkyle, aryle, aralkyle, alkylaryl, alkoxy and aryloxy group, that can be linear, branched, cyclic, poly-cyclic, non-saturated, hydroxylated, carbonylated, phosphorylated and / or sulfured, and which skeletum can comprise an heteroatom, in particular an O, S and / or N atom;—Pro* correspond to a Proline, an analogue or derivative thereof; —if X is H then Y is selected from OR1, NH2, NHR1 and NR1R2, and if Y is OH then X is —CO— or —SO2—R1; and the peptide hypoxanthine-Pro-Pro-Arg being excluded. The invention provides the use of the peptides of above formula I to stimulate the synthesis of the molecules constituting the dermal extracellular matrix, including collagen I and IV and elastin. A cosmetic treatment according to the invention includes anti-aging, anti-wrinkles, improving mechanical properties of the skin, firmness / tone / elasticity / suppleness / flexibility, increasing density and volume of the skin, restructuring effect, fighting stretch marks, improving skin barrier and / or skin hydration.
Owner:SEDERMA SA

Barrel stretch forming process and barrel manufactured by process

The invention relates to a barrel stretch forming process capable of manufacturing a barrel by using a round stock and the barrel manufactured by the process. The barrel stretch forming process comprises the following the steps: supply the round stock; continuously carrying out one-time positive stretch and one-time negative stretch for the round stock in sequence. The barrel achieves the effect of the smooth outer surface and cannot generate stretch marks or a bubbling phenomenon. The barrel stretch forming process continuously carries out one-time positive stretch and one-time negative stretch for the round stock in sequence, so that the forming of the barrel can be completed, and the traditional three steps of stretch procedures is not needed. Moreover, material feeding and internal stress are uniform in the positive and negative stretch processes, the crystal structure is good, the outer surface is smooth, and the stretch marks or the bubbling phenomenon cannot occur. The manufacturing procedure is reduced, the use of corollary equipment is reduced, the cost of labor resources is reduced, the reject rate is lowered, and the production cost is reduced.
Owner:李侨志

Stem cell extract product for eliminating skin striae gravidarum

The invention provides a stem cell extract product for eliminating skin striae gravidarum, and belongs to the field of stem cell technology. The stem cell extract product derives from stem cells of normal placenta or umbilical cord, and solves the technology problems existing in acquirement of stem cells from embryo and umbilical cord as well as separation of the needed stem cells and the like. The stem cell extract product contains a lot of bioactive factors which are good for skin regeneration and repair, products using the stem cell extract product or using the stem cell extract product as a main component can effectively mitigate or even eliminate skin striae gravidarum and do not irritate skin and do not have adverse reactions.
Owner:国健菁华(深圳)精准健康科技有限公司
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More