Unlock instant, AI-driven research and patent intelligence for your innovation.

Anti-human Oct 4 (octamer-binding protein 4) monoclonal antibody as well as preparation and application of anti-human Oct 4 monoclonal antibody

A monoclonal antibody and recombinant protein technology, applied in the field of medical bioengineering, can solve problems such as unclear progression of liver cancer

Active Publication Date: 2015-11-18
SECOND MILITARY MEDICAL UNIV OF THE PEOPLES LIBERATION ARMY
View PDF1 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Previous studies have suggested that liver cancer initiating cells may play an important role in the occurrence and development of liver cancer, but how it regulates the progression of liver cancer is still unclear. So far, it has not been found that the expression level of liver cancer stem cells and Oct4 can be directly used as a prognostic factor for liver cancer recurrence and metastasis, and Related reports for personalized treatment of liver cancer

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Anti-human Oct 4 (octamer-binding protein 4) monoclonal antibody as well as preparation and application of anti-human Oct 4 monoclonal antibody
  • Anti-human Oct 4 (octamer-binding protein 4) monoclonal antibody as well as preparation and application of anti-human Oct 4 monoclonal antibody
  • Anti-human Oct 4 (octamer-binding protein 4) monoclonal antibody as well as preparation and application of anti-human Oct 4 monoclonal antibody

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Embodiment 1. Preparation of recombinant protein of monoclonal antibody against human Oct4

[0035] 1. Construction of prokaryotic expression vector

[0036] Oct4A has 360 amino acids. According to its cDNA sequence information, Baiqi Biotechnology (Shanghai) Co., Ltd. was entrusted to design PCR primers SEQ ID NO: 3 and SEQ ID NO: 4:

[0037]Upstream primer: CCGGAATTCATGGCGGGACACCTGGCTTCGGATT (shown in SEQ ID NO: 3)

[0038] Downstream primer: ATAAGAATGCGGCCGCGTTTGAATGCATGGGAG (shown in SEQ ID NO: 4)

[0039] The cDNA of Oct4 obtained by PCR is shown as SEQ ID NO: 2, and cloned into the expression vector pET21a(+) by molecular cloning. For the method, please refer to J. Sambrook et al., translated by Jin Dongyan et al. "Molecular Cloning Experiment Guide (Second Edition) "reference book.

[0040] 2. Expression and purification of recombinant protein

[0041] The plasmid with 100% matching sequence was transformed into BL21(DE3), and a single colony was taken to ino...

Embodiment 2

[0042] Example 2. Preparation and purification of monoclonal antibody against human Oct4

[0043] 1. Antigen Purification

[0044] The antigen adopts prokaryotic recombinant protein, which is obtained by Baiqi Biotechnology (Shanghai) Co., Ltd. through molecular cloning, prokaryotic induced expression, and purification.

[0045] 2. Preparation and purification of monoclonal antibodies

[0046] Dilute 100 μg of the recombinant protein purified in the above 1 with PBS, mix and emulsify with an equal volume of complete Freund's adjuvant (CFA), and immunize 5 female BALB / c mice aged 5-6 weeks under the skin around the shoulders Subcutaneously and intramuscularly in both hind legs, approximately 1 / 8 of the immunogen was administered to each area, and 1 / 2 of the remaining immunogen was injected intraperitoneally. Two weeks later, booster immunization with 50 μg complete Freund's adjuvant, intraperitoneal injection. Four weeks later, 50 μg of incomplete Freund's adjuvant (IFA) was...

Embodiment 3

[0051] Example 3. Identification and detection application of monoclonal antibody against human Oct4

[0052] 1. Identification of monoclonal antibodies

[0053] (1) Antibody titer identification

[0054] The antigen (4μg / ml) was coated on the ELISA plate, and the purified anti-human Oct4 monoclonal antibody was carried out at 1:1000, 1:2000, 1:4000, 1:8000, 1:16000, 1:32000, 1:64000 Dilute and add to the wells of the microtiter plate, select commercialized Oct4 antibody (1mg / ml1:8000 diluted with milk) as the positive control of the system operation, and 5% milk as the negative control. After the reaction, goat anti-mouse IgG-HRP was added to develop the color. Positive judgment standard: the ratio (P / N) of the OD450 of the test well of the sample to the OD450 of the negative control well is ≥ 2.1, and the result shows that the antibody titer is greater than 64000 (Table 1).

[0055] Table 1 Antibody titer identification table

[0056] Dilution

1 / 1000

1 / 2...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of medical biology engineering, and provides an anti-human Oct 4 (octamer-binding protein 4) monoclonal antibody, recombinant protein for preparing the monoclonal antibody, a hybridoma cell strain secreting the monoclonal antibody as well as applications of the monoclonal antibody in western blot, expression of Oct 4 in immunohistochemical detection samples and preparation of prognosis evaluation preparations for liver cancer.

Description

technical field [0001] The invention relates to the technical field of medical bioengineering, in particular to an anti-human Oct4 monoclonal antibody, a recombinant protein used to prepare the monoclonal antibody, a hybridoma cell line secreting the monoclonal antibody, and the use of the monoclonal antibody in Detecting the expression of Oct4 in a sample and its application in preparing preparations for evaluating the prognosis of liver cancer. Background technique [0002] Oct4 (Octamer-BindingProtein4, also known as POU5F1) is an important transcription factor that maintains stem cell pluripotency and self-renewal. It is mainly expressed in embryonic stem cells, reproductive stem cells and undifferentiated embryonic tumors. It binds to the regulatory region of target genes , to selectively inhibit the expression of differentiation genes or promote the expression of pluripotency genes. Oct-4 is encoded by the Pou5F1 gene (GeneID: 5460). Due to differential splicing, ther...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K16/18C12N5/20G01N33/68G01N33/577G01N33/574
Inventor 王红阳于乐兴文文谈冶雄凌妍陈淑桢
Owner SECOND MILITARY MEDICAL UNIV OF THE PEOPLES LIBERATION ARMY