Application of carbonyl reductase gene, engineering bacteria containing the gene and method for catalyzing reduction reaction

A catalyst and reaction system technology, applied in the asymmetric reduction of carbonyl compounds, carbonyl reductase and its gene field, can solve the problems of environmental pollution, high reaction energy consumption, and difficulty in catalyst recovery, so as to increase the reaction concentration and reduce the Toxicity, efficiency-enhancing effect

Active Publication Date: 2019-04-09
NANJING TECH UNIV
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

These catalysts are difficult to recover, pollute the environment, and the reaction consumes a lot of energy
Biocatalytic chiral resolution does not require the addition of coenzymes, but the disadvantage of this method is that the highest yield of the product of the target configuration will not exceed 50%

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of carbonyl reductase gene, engineering bacteria containing the gene and method for catalyzing reduction reaction
  • Application of carbonyl reductase gene, engineering bacteria containing the gene and method for catalyzing reduction reaction
  • Application of carbonyl reductase gene, engineering bacteria containing the gene and method for catalyzing reduction reaction

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] Embodiment 1: the acquisition of YlCR2 gene

[0047] figure 1 It is the construction diagram of the carbonyl reductase gene YlCR2. According to the gene sequence (Genbank accession number: ) that is predicted to be Yarrowia lipolytica (yarrowia liplytic) reductase included in Genbank, design PCR primers as follows:

[0048] Upstream primer: CG GGATCC ATGCCTGCACCAGCAAC

[0049] Downstream primer: CCG CTCGAG TCAAGGACAACAGTAGCCGCGC

[0050] Wherein, the underlined part of the upstream primer is the BamHI restriction site, and the underlined part of the downstream primer is the XhoI restriction site.

[0051] PCR amplification was performed using the genomic DNA of Yarrowia lipolytica as a template. PCR system (total volume 50μL) is: ddH 2 O 19 μL, 2×Taq Plus Master Mix (Dye Plus) 25 μL, genomic DNA 2 μL, upstream primer and downstream primer 2 μL each. The PCR reaction conditions were: 94°C for 5 min; 30 cycles of 94°C for 30 s, 56°C for 30 s, 72°C for 1 min; 72°...

Embodiment 2

[0052] Embodiment 2: the acquisition of recombinant bacterial strain E.coli BL21 / pETY1CR2

[0053] The recombinant plasmid pMD19-T-YlCR2 and the commercial vector pET28a were digested with restriction endonucleases BamHI and XhoI respectively. After the treatment, the DNA fragments were ligated by sticky ends to obtain the recombinant expression vector pET28a-YlCR2. Transform the recombinant expression vector pET28a-YlCR2 into Escherichia coli BL21(DE3), smear it on an LB plate containing kanamycin resistance at a final concentration of 50ug / mL, and randomly pick positive clones. For the recombinant plasmid, see image 3 , colony PCR see Figure 4 , Sequencing verification, using software to analyze the sequencing results, the sequence is identical to the nucleotide sequence of the YlCR2 gene. The result shows that recombinant E. coli E.coli BL21 / pETYlCR2 has been obtained

Embodiment 3

[0054] Embodiment 3: the cultivation of recombinant bacteria

[0055] Inoculate the recombinant Escherichia coli E.coli BL21 / pETY1CR2 thallus obtained in Example 2 into 50 mL of LB liquid medium containing 50 ug / mL kanamycin, and cultivate overnight at 37° C. with shaking at 200 rpm; Inoculated in 50 mL of LB liquid medium containing 50 ug / mL kanamycin, cultured at 37°C with shaking at 200 rpm to OD600 0.8, added inducer isopropyl-β-D-thiogalactoside ( IPTG) 0.1 mmol / L, induced culture at 30° C. for 10 h; centrifuge at 5000 rpm for 10 min, collect the bacterial cells, wash with physiological saline, and collect whole cells of the recombinant bacteria. The bacterium can be used directly as a biocatalyst or for protein purification.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a recombinant carbonyl reductase derived from Yarrowia lipolytica, a coding gene of the recombinant carbonyl reductase, a recombinant carrier containing the coding gene, a recombinant genetically engineered bacterium obtained by converting the recombinant carrier, and application of the recombinant carbonyl reductase or the recombinant genetically engineering bacterium to preparation of optically active chiral alcohol from asymmetrically reduction of carbonyl compounds as catalysts. When the recombinant carbonyl reductase is taken as a catalyst, various carbonyl compounds can be reduced asymmetrically to prepare the optically active chiral alcohol, the catalysis efficiency is high, and the stereoselectivity is strong. The recombinant genetically engineered bacterium is taken as a catalyst for asymmetrically reducing 4-chloro-acetoacetic ester (COBE), and further efficiently preparing (S)-4-chloro-3-hydroxy ethyl butyrate, so that a reaction system of coupled substrates is built.

Description

technical field [0001] The invention belongs to the technical field of biocatalytic asymmetric transformation, and relates to a carbonyl reductase and its gene, as well as the construction of a recombinant bacterial strain by means of genetic engineering and its application in the asymmetric reduction of carbonyl compounds. Background technique [0002] Optically active chiral alcohols are important intermediates in the synthesis of pharmaceuticals and fine chemicals. For example, (S)-4-chloro-3-hydroxybutanoate (Ethyl 4-chloro-3-hydroxybutanoate, (S)-CHBE) is an important chiral intermediate, which can be used in the synthesis of many active drugs , such as statins - hydroxymethylglutaryl CoA (HMG-CoA) reductase inhibitors and 4-hydroxypyrrolidone (4-hydroxypyrrolidone) and so on. [0003] At present, the preparation methods of optically active chiral alcohols mainly include chemically catalyzed carbonyl asymmetric reduction, biocatalyzed carbonyl asymmetric reduction and ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N9/04C12N15/70C12N1/21C12P7/26C12P7/22C12P7/04C12P7/62C12R1/19
CPCC12N9/0006C12P7/04C12P7/22C12P7/26C12P7/62C12Y101/01184
Inventor李霜许芹黄和徐勇邓波曾凤鸣
OwnerNANJING TECH UNIV