Varroa destructor toxic protein and coding gene thereof, and application thereof
A virulent protein, Varroa destructor technology, applied in the field of biochemistry and molecular biology
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0014] 1. Cloning of toxin protein gene
[0015] Get about 60 Varroa mites, use TriZolReagent (Invitrogen Company, its article number: 15596026) to extract total RNA, use agarose gel electrophoresis and ultraviolet spectrophotometer to detect the purity and amount of total RNA, and take 1 μg of total RNA to make Initiate the reverse transcription reaction, the reverse transcription kit used is SMARTer TM For the RACEcDNA Amplification Kit (Clontech, catalog number: 634923), the steps of the reverse transcription reaction refer to the instructions of the kit to obtain the reverse transcription product.
[0016] Using the reverse transcription product as a template, design specific primers for the VMP gene:
[0017] VMPF1 (5'ATGTTCAAACTTCTCGTTATCG3')
[0018] VMPR1 (5'TTAGGAGGCGAGCGCCTGCTGGA3')
[0019] Use high-fidelity Taq enzyme for PCR. The PCR reaction system is: reverse transcription product 1 μL, 10xBuffer 5 μL, dNTP (each 2.5 mM) 4 μL, VMPF1 (10 μM) 1 μL, VMPR1 (10 μM...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 