Varroa destructor toxic protein and coding gene thereof, and application thereof

A virulent protein, Varroa destructor technology, applied in the field of biochemistry and molecular biology

Active Publication Date: 2015-11-25
INST OF ZOOLOGY GUANGDONG ACAD OF SCI
View PDF6 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But this uncapping and removal behavior is not specific to Varroa mites, but a general c

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Varroa destructor toxic protein and coding gene thereof, and application thereof
  • Varroa destructor toxic protein and coding gene thereof, and application thereof
  • Varroa destructor toxic protein and coding gene thereof, and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0014] 1. Cloning of toxin protein gene

[0015] Get about 60 Varroa mites, use TriZolReagent (Invitrogen Company, its article number: 15596026) to extract total RNA, use agarose gel electrophoresis and ultraviolet spectrophotometer to detect the purity and amount of total RNA, and take 1 μg of total RNA to make Initiate the reverse transcription reaction, the reverse transcription kit used is SMARTer TM For the RACEcDNA Amplification Kit (Clontech, catalog number: 634923), the steps of the reverse transcription reaction refer to the instructions of the kit to obtain the reverse transcription product.

[0016] Using the reverse transcription product as a template, design specific primers for the VMP gene:

[0017] VMPF1 (5'ATGTTCAAACTTCTCGTTATCG3')

[0018] VMPR1 (5'TTAGGAGGCGAGCGCCTGCTGGA3')

[0019] Use high-fidelity Taq enzyme for PCR. The PCR reaction system is: reverse transcription product 1 μL, 10xBuffer 5 μL, dNTP (each 2.5 mM) 4 μL, VMPF1 (10 μM) 1 μL, VMPR1 (10 μM...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a Varroa destructor toxic protein and a coding gene thereof, and application thereof. According to the invention, the novel coding gene VMP of the Varroa destructor toxic protein VMP is cloned from the genome of Varroa destructor; an expression product of the coding gene, i.e., the Varroa destructor toxic protein VMP, has toxic effect on honeybees; thus, the Varroa destructor toxic protein VMP and the coding gene thereof can be applied to lethal drugs for honeybees. Moreover, conditions are created for basic scientific research on the mechanism of harm to honeybees by the Varroa destructor.

Description

Technical field: [0001] The invention belongs to the field of biochemistry and molecular biology, and specifically relates to a toxic protein of Varroa dissimilar mite, its coding gene and its application. Background technique: [0002] Varroa mite has always been one of the most important hazards to beekeeping in the world, and it has not been found in Australia only in the world (Zhou Ting, 2005; Rosenkranze et al., 2010). Varroa dissimilar sucks the body fluids of adult bees or larvae, causing the decline of bee physique, and at the same time reducing the cognitive ability and sense of direction of bees (Kralje et al., 2007), reducing the return rate of busy bees, and shortening the lifespan of bees (Dainate et al., 2012), the bee colony is weak. The most important thing is that Varroa disis also spreads bacterial and viral diseases of bees (Tentcheva et al., 2004; Yan et al., 2009; Prisco et al., 2011, Aie et al., 2012), and activates these latent viruses by inhibiting ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C07K14/435C12N15/12A01N47/44A01P7/04
Inventor 张祎韩日畴
Owner INST OF ZOOLOGY GUANGDONG ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap