A broad-spectrum anti-phytopathogenic fungus Bacillus and its application

A technology for bacillus and plant pathogenicity, which is applied to the preparation and control of plant pathogenic fungi, in the field of bacillus with broad-spectrum resistance to plant pathogenic fungi, can solve the problems of drug resistance of pathogenic bacteria, decreased control effect, etc., and achieve antifungal control. Wide spectrum, simple preparation process, good biocontrol effect

Inactive Publication Date: 2018-10-09
THIRD INST OF OCEANOGRAPHY STATE OCEANIC ADMINISTATION +1
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the long-term single use of the same chemical agent will make the pathogenic bacteria resistant to the chemical agent, and the control effect will decrease year by year.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A broad-spectrum anti-phytopathogenic fungus Bacillus and its application
  • A broad-spectrum anti-phytopathogenic fungus Bacillus and its application
  • A broad-spectrum anti-phytopathogenic fungus Bacillus and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1: Isolation and screening of Bacillus sp. DY26-014

[0024] The present invention relates to Bacillus sp. DY26-014 which is isolated from sediment samples collected during the 26th Oceanic Science Expedition in China. The bacterium grows on LB medium. After culturing at 28°C for 24 hours, the bacterium is light yellow and the colonies are large. figure 1 .

Embodiment 2

[0025] Embodiment 2: Bacillus sp. (Bacillus sp.) DY26-014 strain identification

[0026] The universal forward primer 27F and universal reverse primer 1492R of the 16s rDNA gene were designed and synthesized, and their nucleic acid sequences were 27F: AGAGTTTGATCCTGGCTCAT; 1492R: ACGGCTACCTTGTTACGACTT. The DY26-014 cells cultured for 24 hours were collected by centrifugation, and the total DNA was extracted with a genomic DNA extraction kit. The 16S rDNA sequence of DY26-014 was amplified using the total DNA as a PCR amplification template. The reaction conditions were: denaturation at 94°C for 1 min; annealing at 55°C for 1 min; extension at 72°C for 1.5 min, 30 cycles. The amplified gene was sent to the sequencing company for sequencing. After obtaining the 16S rDNA sequence of the strain, the sequence was passed and compared with the nucleic acid data in the National Center for Biotechnology Information (NCBI) and GeneBank ( http: / / ncbi.nlm.nih.gov / blast ). It was fo...

Embodiment 3

[0027] Embodiment 3: the mensuration of phytopathogenic fungi antimicrobial spectrum

[0028] The inhibitory activity of Bacillus sp. DY26-014 against 10 plant pathogenic fungi was determined by the filter paper method. Use a sterile puncher with a diameter of 6mm to make bacterial blocks from the tested pathogenic fungi, pick a bacterial block with a toothpick and place it in the center of a solid potato medium (PDA) plate, and culture it at 28°C for 1 to 2 days. After waiting for the mycelium of the pathogenic fungus to spread and grow, place a number of sterilized double-layer filter paper sheets with a diameter of 6mm around the bacterial block. Sterile fermentation supernatant. Continue to cultivate for 2 to 3 days, and observe whether the growth of the mycelium is inhibited by comparing with the control culture. If the mycelium of the tested pathogenic fungus is inhibited, the mycelium will form a crescent-shaped or linear edge. The result is as figure 2 Shown, Bacil...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses broad-spectrum plant-pathogenic-fungus-resistant bacillus and application thereof and belongs to bacillus. The preservation number of the bacillus (Bacillus sp.) DY26-014 is CCTCC NO:M2015408. The bacillus (Bacillus sp.)DY26-014 can be used for preparing plant pathogenic fungus fermentative supernatant liquid. Plant pathogenic fungi prevented by the bacillus DY26-014 comprise fusarium spp, gloeosporium musarum, paecilomyces variotii, sclerotinia sclerotiorum, alternaria longipes, trichoderma viride, rhizoctonia, mutualism alternaria, botrytis cinerea and colletotrichum dematium. The broad-spectrum plant-pathogenic-fungus-resistant bacillus has a good effect in a potted experiment for preventing sclerotinia rot of colza, and the preventing effect can be 61.9%. Fermentative supernatant liquid of the bacillus (Bacillus sp.)DY26-014 has the advantages that the preparation technology is simple, the fungus suppression spectrum is broad, and the action effect is remarkable.

Description

technical field [0001] The invention relates to a bacillus, in particular to a bacillus strain with broad-spectrum resistance to plant pathogenic fungi and its application in preparing and preventing plant pathogenic fungi. Background technique [0002] The ocean has an area nearly 2.5 times that of the land, and contains rich biological and chemical resources. Because marine organisms live in special environments such as hypertonicity, high salinity, low temperature, high pressure, and low oxygen, they can produce various active substances with special physiological functions in the process of growth and metabolism (Gao Xiaoning, Chen Jinyan, Huang Lili, etc. Screening and prevention of endophytic antagonistic bacteria against Sclerotinia sclerotiorum [J]. Journal of Pesticide Science, 2010(2):7-10). Among these marine biological resources, the rich and diverse, novel and unique marine microorganisms are ideal resources for discovering new materials, new functions, new gen...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/20A01N63/00A01P3/00
Inventor 陈新华吴小君郭文斌
Owner THIRD INST OF OCEANOGRAPHY STATE OCEANIC ADMINISTATION
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap