A broad-spectrum anti-phytopathogenic fungus Bacillus and its application
A technology for bacillus and plant pathogenicity, which is applied to the preparation and control of plant pathogenic fungi, in the field of bacillus with broad-spectrum resistance to plant pathogenic fungi, can solve the problems of drug resistance of pathogenic bacteria, decreased control effect, etc., and achieve antifungal control. Wide spectrum, simple preparation process, good biocontrol effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] Example 1: Isolation and screening of Bacillus sp. DY26-014
[0024] The present invention relates to Bacillus sp. DY26-014 which is isolated from sediment samples collected during the 26th Oceanic Science Expedition in China. The bacterium grows on LB medium. After culturing at 28°C for 24 hours, the bacterium is light yellow and the colonies are large. figure 1 .
Embodiment 2
[0025] Embodiment 2: Bacillus sp. (Bacillus sp.) DY26-014 strain identification
[0026] The universal forward primer 27F and universal reverse primer 1492R of the 16s rDNA gene were designed and synthesized, and their nucleic acid sequences were 27F: AGAGTTTGATCCTGGCTCAT; 1492R: ACGGCTACCTTGTTACGACTT. The DY26-014 cells cultured for 24 hours were collected by centrifugation, and the total DNA was extracted with a genomic DNA extraction kit. The 16S rDNA sequence of DY26-014 was amplified using the total DNA as a PCR amplification template. The reaction conditions were: denaturation at 94°C for 1 min; annealing at 55°C for 1 min; extension at 72°C for 1.5 min, 30 cycles. The amplified gene was sent to the sequencing company for sequencing. After obtaining the 16S rDNA sequence of the strain, the sequence was passed and compared with the nucleic acid data in the National Center for Biotechnology Information (NCBI) and GeneBank ( http: / / ncbi.nlm.nih.gov / blast ). It was fo...
Embodiment 3
[0027] Embodiment 3: the mensuration of phytopathogenic fungi antimicrobial spectrum
[0028] The inhibitory activity of Bacillus sp. DY26-014 against 10 plant pathogenic fungi was determined by the filter paper method. Use a sterile puncher with a diameter of 6mm to make bacterial blocks from the tested pathogenic fungi, pick a bacterial block with a toothpick and place it in the center of a solid potato medium (PDA) plate, and culture it at 28°C for 1 to 2 days. After waiting for the mycelium of the pathogenic fungus to spread and grow, place a number of sterilized double-layer filter paper sheets with a diameter of 6mm around the bacterial block. Sterile fermentation supernatant. Continue to cultivate for 2 to 3 days, and observe whether the growth of the mycelium is inhibited by comparing with the control culture. If the mycelium of the tested pathogenic fungus is inhibited, the mycelium will form a crescent-shaped or linear edge. The result is as figure 2 Shown, Bacil...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap