Check patentability & draft patents in minutes with Patsnap Eureka AI!

Application of chitin synthase chsa‑2b/19b from lepidopteran insects in pest control

A technology of chitin synthase and Lepidoptera insects, applied in the fields of application, insecticide, biocide, etc., can solve the problems of no report and unclear function of CHSA-2b

Active Publication Date: 2017-10-10
SOUTH CHINA NORMAL UNIVERSITY
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But the function of CHSA-2b remains unclear
And so far there is no report on the function of epidermal chitinase in different cutting modes in insect wing development

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of chitin synthase chsa‑2b/19b from lepidopteran insects in pest control
  • Application of chitin synthase chsa‑2b/19b from lepidopteran insects in pest control
  • Application of chitin synthase chsa‑2b/19b from lepidopteran insects in pest control

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Example 1 Bombyx mori wing deformity with suppressed expression of BmCHSA-2b

[0030] (1) silkworm BmCHSA-2b and BmCHSA-19b dsRNA synthesis

[0031] Bombyx mori were synthesized according to the instructions of the kit T7 RiboMAX™ Express RNAi System (purchased from Promega) BmCHSA-2b dsRNA, BmCHSA-19b dsRNA and GFPdsRNA, the sequence of each dsRNA is as follows.

[0032] 1) Exon of silkworm CHSA 2b The cDNA sequence is:

[0033] ATTATGAGTGAACAAGAACGTAGGAGTCAATACGAGAACGAGGAGACGGAGGAAGTCGTTTACATTCCAAATAACAATTACTCGATATACAGTAATGGAACTTTGCATTACTGTAGCATATACAG (SEQ ID NO: 1).

[0034] 2) silkworm BmCHSA-2b dsRNA (hereinafter referred to as ds BmCHSA-2b ) sequence is:

[0035] GGAGACGGAGGAAGUCGUUUACAUUCCAAAUAACAAUUACUCGAUAUACAGUAAUGGAACUUUGCAUUACUGUAGCAUAUACAGUCAGCGCACAGUACAAGAAACGAAAGGAUGGGACGUGUUCAGAGAAUUUCCGCCGAAACAGGACAGUGUGUCCAUGGAGACUCAGAAAUGUUUGGAAUUCACAGUGCGAAUGUUAAAAGUGGUCGCUUACCUGGUCACCUUCAUCGUGGUCCUUGGAUCAGGAGUUAUCGCAAAGGGGACAAUUUUGUUCAUGACGUCAC...

Embodiment 2

[0063] Example 2 Spodoptera litura SlCHSA-2b / 19brole in wing development

[0064] In order to prove that other species of Lepidoptera contain exons 2b, 19b Does the chitin synthase also have the same BmCHSA-2b , BmCHSA-19b The same function, the present embodiment clones Spodoptera litura containing 2b and 19b full-length cDNA, and the exon 2b Fragments were subjected to RNAi experiments. The results showed that Spodoptera litura contains exon 2b chitin synthase has the same exon-containing 2b The same function of chitin synthase also affects pupal wing development.

[0065] (1) Spodoptera litura SlCHSA-2b cDNA sequence and SlCHSA-2b dsRNA synthesis

[0066] Spodoptera litura SlCHSA exon 2b The cDNA sequence is:

[0067] TATGAGTGATAACGATCGTAAAAGTCACTATGAAAGGGACGATGCCGAGGAACCGCTTTATGTCGCCAACAACAATAATTCAATTTACAGCAATGGGACTTTGCATTATTGTAGCATATACAG (SEQ ID NO: 6).

[0068] Spodoptera litura SlCHSA-2b dsRNA (hereinafter referred to as dsSlCHSA-2b ) sequence ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses the application of chitin synthase CHSA‑2b / 19b of lepidopteran insects in pest control. The invention discovers malformed wing veins of insects by fully injecting dsRNA that interferes with exon 2b and 19b of lepidopteran insects. Wrinkled and thin, wings smaller, indicating that transcripts containing 2b and / or 19b affect insect wing development. Artificial substances that inhibit the expression of chitin synthase transcripts containing 2b and / or 19b in lepidopteran insects or compounds screened from plants can be used as inhibitors, such as injecting dsRNA of CHSA-2b to lepidopteran insects, The purpose of pest control can be achieved. Similarly, substances that promote the degradation of chitin synthase transcripts containing 2b and / or 19b in Lepidoptera insects, or substances that inhibit the normal function of chitin synthase transcripts containing 2b and / or 19b As a pest insecticide, it can achieve the purpose of pest control.

Description

technical field [0001] The present invention relates to the application of exons 2b and 19b of the chitin synthase gene of Lepidoptera insects in pest control, and specifically relates to the function of CHSA-2b / 19b affecting the development of pupal wings of Lepidoptera insects, so as to develop around the gene The research and development of transgenes or inhibitors can achieve the purpose of pest control by hindering the normal development of insect wings, affecting their flight, courtship and reproduction. Background technique [0002] The main component of insect skin and wings is chitin, which is the second largest biopolymer after cellulose. It is a linear polysaccharide complex composed of N-acetyl-β-D Glucosamine (β-N-Acetyl-D-glucosamine) is polymerized through β-1,4 glycosidic bonds. In arthropods, chitin is an important component of the epidermal exoskeleton, which plays an important role in the growth and development of arthropods. The content of chitin in ins...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): A01N57/16A01P7/04C12N15/54
Inventor 郑思春徐关峰刘佳张婕李冬冬
Owner SOUTH CHINA NORMAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More