Application of chitin synthase chsa‑2b/19b from lepidopteran insects in pest control
A technology of chitin synthase and Lepidoptera insects, applied in the fields of application, insecticide, biocide, etc., can solve the problems of no report and unclear function of CHSA-2b
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] Example 1 Bombyx mori wing deformity with suppressed expression of BmCHSA-2b
[0030] (1) silkworm BmCHSA-2b and BmCHSA-19b dsRNA synthesis
[0031] Bombyx mori were synthesized according to the instructions of the kit T7 RiboMAX™ Express RNAi System (purchased from Promega) BmCHSA-2b dsRNA, BmCHSA-19b dsRNA and GFPdsRNA, the sequence of each dsRNA is as follows.
[0032] 1) Exon of silkworm CHSA 2b The cDNA sequence is:
[0033] ATTATGAGTGAACAAGAACGTAGGAGTCAATACGAGAACGAGGAGACGGAGGAAGTCGTTTACATTCCAAATAACAATTACTCGATATACAGTAATGGAACTTTGCATTACTGTAGCATATACAG (SEQ ID NO: 1).
[0034] 2) silkworm BmCHSA-2b dsRNA (hereinafter referred to as ds BmCHSA-2b ) sequence is:
[0035] GGAGACGGAGGAAGUCGUUUACAUUCCAAAUAACAAUUACUCGAUAUACAGUAAUGGAACUUUGCAUUACUGUAGCAUAUACAGUCAGCGCACAGUACAAGAAACGAAAGGAUGGGACGUGUUCAGAGAAUUUCCGCCGAAACAGGACAGUGUGUCCAUGGAGACUCAGAAAUGUUUGGAAUUCACAGUGCGAAUGUUAAAAGUGGUCGCUUACCUGGUCACCUUCAUCGUGGUCCUUGGAUCAGGAGUUAUCGCAAAGGGGACAAUUUUGUUCAUGACGUCAC...
Embodiment 2
[0063] Example 2 Spodoptera litura SlCHSA-2b / 19brole in wing development
[0064] In order to prove that other species of Lepidoptera contain exons 2b, 19b Does the chitin synthase also have the same BmCHSA-2b , BmCHSA-19b The same function, the present embodiment clones Spodoptera litura containing 2b and 19b full-length cDNA, and the exon 2b Fragments were subjected to RNAi experiments. The results showed that Spodoptera litura contains exon 2b chitin synthase has the same exon-containing 2b The same function of chitin synthase also affects pupal wing development.
[0065] (1) Spodoptera litura SlCHSA-2b cDNA sequence and SlCHSA-2b dsRNA synthesis
[0066] Spodoptera litura SlCHSA exon 2b The cDNA sequence is:
[0067] TATGAGTGATAACGATCGTAAAAGTCACTATGAAAGGGACGATGCCGAGGAACCGCTTTATGTCGCCAACAACAATAATTCAATTTACAGCAATGGGACTTTGCATTATTGTAGCATATACAG (SEQ ID NO: 6).
[0068] Spodoptera litura SlCHSA-2b dsRNA (hereinafter referred to as dsSlCHSA-2b ) sequence ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



