Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Mycobacterium tuberculosis Rv3457c recombinant protein as well as preparation method and application thereof

A technology of Mycobacterium tuberculosis, rv3457c, applied in the direction of botany equipment and methods, biochemical equipment and methods, applications, etc., can solve the problem of low diagnostic value and achieve high sensitivity effect

Inactive Publication Date: 2016-02-03
SHANGHAI JIAO TONG UNIV
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, PPD has cross-reactions with environmental mycobacteria and BCG vaccine strains, so the diagnostic value is low

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Mycobacterium tuberculosis Rv3457c recombinant protein as well as preparation method and application thereof
  • Mycobacterium tuberculosis Rv3457c recombinant protein as well as preparation method and application thereof
  • Mycobacterium tuberculosis Rv3457c recombinant protein as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Construction of embodiment 1 recombinant plasmid pET28a-Rv3457c

[0038] (1) Target gene primer design

[0039] Rv3457c-F (SEQ ID No: 3): GGAATTCCATATGCTGATCTCCACAGCGCCCCACCCTGTC;

[0040] Rv3457c-R (SEQ ID No: 4): CCGCTCGAGAGGACTACGCCGAAACCGAACAGCTT

[0041] The enzyme cutting sites are NdeI and XhoI respectively.

[0042] (2) PCR amplification, cloning and sequence determination of the target gene

[0043] Mycobacterium tuberculosis H 37Rv genomic DNA was used as a template, Rv3457c-F and Rv3457c-R were used as primers, and the Rv3457c protein gene was directly amplified by PCR using Taq enzyme (Bao Bioengineering (Dalian) Co., Ltd.). PCR reaction conditions: pre-denaturation at 94°C for 5 minutes; (94°C, 30s; 58°C, 30s; 72°C, 40s) 35 cycles; extension at 72°C for 5 minutes; storage at 4°C. After the reaction, the target fragment was separated by 1% agarose gel electrophoresis, and then recovered with a DNA recovery kit (Invitrogen). Digested with NdeI and XhoI,...

Embodiment 2

[0044] Example 2 Induced expression and purification of recombinant protein Rv3457c

[0045] The eppdorf tube containing 100 μl of BL21(DE3) physS competent cells (TIANGEN) was immediately placed on ice from the -80°C freezer. After 3-5 minutes, wait for the liquid in the tube to melt, put 0.5 μl of the recombinant pET32a-Rv3457c plasmid with correct sequencing into competent cells, place it on ice for 45 minutes, place it in a water bath at 42°C, heat shock it for 90 seconds, and let it stand on ice for 3 minutes. Add 500 μl of preheated LB medium without antibiotics, shake at 37°C, 220rmp, and incubate for 45-60min. Take a certain amount and spread it on a solid LB medium plate containing kanamycin, dry it at room temperature and place it upside down in a 37°C incubator for overnight cultivation. Pick the clones, put them into LB liquid medium containing 50μg / ml kanamycin resistance, culture at 220rmp, 37°C to OD to about 0.6, add the final concentration of 10mMIPTG, 37°C f...

Embodiment 3

[0047] Example 3 Recombinant Rv3457c antigen is used as a detection reagent to detect clinically suspected tuberculosis patients

[0048] In this example, the recombinant Rv3457c antigen is used as a detection reagent to detect clinically suspected tuberculosis patients, and healthy people are used as a control group. At the same time, the commonly used tuberculosis diagnostic antigens ESAT-6 and CFP-10 are used to conduct experiments in groups simultaneously. The ELISPOT test design for specific antigens See Table 1, the operation steps are as follows:

[0049] 1. Sample collection: Aseptically collect about 5ml of human peripheral venous blood into a heparin anticoagulant tube. After collection, the sample can be stored at room temperature, and should not be placed in a refrigerator or freezer; and marked;

[0050] 2. Separation, collection and counting of peripheral blood mononuclear lymphocytes:

[0051] a. Take 5ml of whole blood, add an equal volume of RTPMI-1640 serum-...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a mycobacterium tuberculosis Rv3457c recombinant protein as well as a preparation method and application thereof. The amino acid sequence of the mycobacterium tuberculosis Rv3457c recombinant protein is expressed as SEQ ID NO:1. The invention also provides an encoding nucleotide sequence of the mycobacterium tuberculosis Rv3457c recombinant protein and a preparation method of the recombinant protein. The invention firstly reports a mycobacterium tuberculosis immunodominance antigen Rv3457c based on the research achievement of the immunomics. The mycobacterium tuberculosis immunodominance antigen Rv3457c is applied to cellular immunological diagnosis of the tuberculosis and has higher sensitivity; compared with the conventional skin test, the mycobacterium tuberculosis immunodominance antigen Rv3457c is relatively rapid, safe and reliable.

Description

technical field [0001] The invention belongs to the field of biomedical in vitro diagnostic reagents, in particular to a recombinant protein of a novel tuberculosis T cell immune marker Rv3457c, its preparation method and its application in cellular immune diagnosis. Background technique [0002] Tuberculosis is caused by the pathogen Mycobacterium tuberculosis infecting the body, and it is still an important infectious disease for humans. Rapid and accurate diagnosis of Mycobacterium tuberculosis (MTB) infection is of great significance for the control of tuberculosis. There are many diagnostic methods for MTB infection, and the most commonly used clinical method still relies on traditional sputum smear bacteriological examination, but the detection rate is low; MTB culture can be used as the "gold standard" for the diagnosis of tuberculosis, but the culture time is too long , generally 4-6 weeks, it is difficult to meet the clinical needs; Bactec technology shortens the c...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/35C12N15/31C12N15/70G01N33/68G01N33/569
CPCC07K14/35G01N33/5695G01N33/68
Inventor 张舒林李荣秀马国荣余晓丽郭晓奎王洪海
Owner SHANGHAI JIAO TONG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com