A kind of transglutaminase with improved thermostability
A technology of glutamine and thermal stability, applied in the direction of acyltransferase, transferase, enzyme, etc., can solve the problems of application limitation, poor thermal stability, low catalytic activity, etc., and achieve the effect of reducing production cost and improving production efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0022] The acquisition of embodiment 1 amphipathic short peptide
[0023] The amino acid sequence of the parental short peptide is AEAEAKAKAEAEAKAK, and the DNA sequence corresponding to the amino acid sequence is designed on the primer:
[0024] Upstream primers M-F: GCAGAAGCAGAAGCGAAAGCCAAAGCGGAGGCGGAAGCTAAGGCTAAACGGGCCCCCGACGCTGC
[0025] Downstream primer M-R: GAAGAGCGCACTGACGCTCGGC
Embodiment 2
[0026] Example 2 Construction of a recombinant strain in which a parental short peptide is inserted at the N-terminus of the mature enzyme
[0027] Using the S. hygroscopicus pro-TGase expression plasmid pET-22b(+) / pro-TG as a template, the whole plasmid PCR was carried out with the primers in the above-mentioned Example 1.
Embodiment 3
[0028] Embodiment 3 Recombinant bacterial strain fermentation produces TGase
[0029] The plasmid with the correct sequencing, named N, was transformed into E.coli BL 21, and the transformants were selected and inoculated into LB liquid medium, cultured at 37°C for 12 hours, and then transferred to TB medium with an inoculation amount of 3%, when OD 600 When it reaches 2.0, induce with IPTG at a final concentration of 0.4mmol / mL, and culture for 48 hours at 20°C.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


