Unlock instant, AI-driven research and patent intelligence for your innovation.

A kind of transglutaminase with improved thermostability

A technology of glutamine and thermal stability, applied in the direction of acyltransferase, transferase, enzyme, etc., can solve the problems of application limitation, poor thermal stability, low catalytic activity, etc., and achieve the effect of reducing production cost and improving production efficiency

Active Publication Date: 2019-05-10
JIANGNAN UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The special catalytic ability of TGase makes it widely used in food, textile and other industrial production, but its low catalytic activity and poor thermal stability make the application of TGase as an excellent catalyst in industry severely limited.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of transglutaminase with improved thermostability
  • A kind of transglutaminase with improved thermostability
  • A kind of transglutaminase with improved thermostability

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] The acquisition of embodiment 1 amphipathic short peptide

[0023] The amino acid sequence of the parental short peptide is AEAEAKAKAEAEAKAK, and the DNA sequence corresponding to the amino acid sequence is designed on the primer:

[0024] Upstream primers M-F: GCAGAAGCAGAAGCGAAAGCCAAAGCGGAGGCGGAAGCTAAGGCTAAACGGGCCCCCGACGCTGC

[0025] Downstream primer M-R: GAAGAGCGCACTGACGCTCGGC

Embodiment 2

[0026] Example 2 Construction of a recombinant strain in which a parental short peptide is inserted at the N-terminus of the mature enzyme

[0027] Using the S. hygroscopicus pro-TGase expression plasmid pET-22b(+) / pro-TG as a template, the whole plasmid PCR was carried out with the primers in the above-mentioned Example 1.

Embodiment 3

[0028] Embodiment 3 Recombinant bacterial strain fermentation produces TGase

[0029] The plasmid with the correct sequencing, named N, was transformed into E.coli BL 21, and the transformants were selected and inoculated into LB liquid medium, cultured at 37°C for 12 hours, and then transferred to TB medium with an inoculation amount of 3%, when OD 600 When it reaches 2.0, induce with IPTG at a final concentration of 0.4mmol / mL, and culture for 48 hours at 20°C.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to glutamine transaminase, in particular to glutamine transaminase with increased thermal stability. The thermal stability of the glutamine transaminase is increased by fusing and expressing amphiphilic oligopeptides at the N end of the mature glutamine transaminase.

Description

technical field [0001] The invention relates to a transglutaminase, in particular to a transglutaminase with improved thermostability. Background technique [0002] Transglutaminase (Transglutaminase, EC 2.3.2.13, TGase) is a protein that can undergo amido transfer reaction and finally form ε-(γ-glutamyl) lysine covalent bond. Based on the existence of the above catalytic reactions, TGase can promote the hydrolysis of various protein intermolecular and intramolecular crosslinks and glutamine residues, thereby improving various functional properties of proteins, such as emulsification, solubility, etc.; at the same time, TGase can By introducing some small molecular substances such as lysine into protein, the nutritional value of protein can be increased. Therefore, TGase is widely used in the market as a unique food additive in the processing of food such as flour products, dairy products, baked products, meat products and aquatic products, and the market demand is extremel...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/10
CPCC12N9/1044C12Y203/02013
Inventor 刘松童理明陈坚堵国成
Owner JIANGNAN UNIV