Method for parallel determination of activity of uracil-DNA glycosylase and endonuclease IV, application thereof and reagent kit
A technology of glycosylase and uracil, which is applied in the field of medicine, can solve the problems of increasing the complexity of probe design, and achieve the effect of simplified design and good selectivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] 1 Reagents and instruments
[0037] The DNA oligonucleotides used in this work were synthesized and purified by Sangon (Shanghai, China),
[0038] Sequences of hairpin probes:
[0039] GTGGTGAGGAGTGAGGTAGGTGGTATAAACTTAGGATCGTGTGGTTUATACCACCTACCTCACTCCTCCACCAC;
[0040] Sequence of padlock templates:
[0041] GATCCTAACCCAACCCGCCCTACCCAAAACCCAACCCGCCCTACCCAAAACCCAACCCGCCCTACCCAACCACAC.
[0042] Uracil-DNA Glycosylase (UDG), Endonuclease IV (EndoIV), Uracil Glycosylase Inhibitor (UGI), Human 8-Oxidative Guanine DNA Glycoamylase (hOGG1), Human Alkylated Glycosylase Purine DNA glycosylase (hAAG), restriction endonuclease HpaII, and T7 endonuclease I (T7EndoI) were obtained from New England Biolabs (Beijing, China). T4 DNA ligase, phi29 DNA polymerase, and dNTPs were purchased from Fuzyces (Beijing, China). N-Methyl-porphyrin IX (NMM) was purchased from Frontier Science, Inc. (Logan, Utah, USA). Stock solutions of NMM were prepared in dimethyl sulfoxide (DMSO) and store...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap