Method for parallel determination of activity of uracil-DNA glycosylase and endonuclease IV, application thereof and reagent kit

A technology of glycosylase and uracil, which is applied in the field of medicine, can solve the problems of increasing the complexity of probe design, and achieve the effect of simplified design and good selectivity

Active Publication Date: 2016-04-20
SHANDONG UNIV
View PDF0 Cites 14 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the above-mentioned label-free fluorescence strategy has realized the activity detection of UDG or EndoIV, different sens

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for parallel determination of activity of uracil-DNA glycosylase and endonuclease IV, application thereof and reagent kit
  • Method for parallel determination of activity of uracil-DNA glycosylase and endonuclease IV, application thereof and reagent kit
  • Method for parallel determination of activity of uracil-DNA glycosylase and endonuclease IV, application thereof and reagent kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] 1 Reagents and instruments

[0037] The DNA oligonucleotides used in this work were synthesized and purified by Sangon (Shanghai, China),

[0038] Sequences of hairpin probes:

[0039] GTGGTGAGGAGTGAGGTAGGTGGTATAAACTTAGGATCGTGTGGTTUATACCACCTACCTCACTCCTCCACCAC;

[0040] Sequence of padlock templates:

[0041] GATCCTAACCCAACCCGCCCTACCCAAAACCCAACCCGCCCTACCCAAAACCCAACCCGCCCTACCCAACCACAC.

[0042] Uracil-DNA Glycosylase (UDG), Endonuclease IV (EndoIV), Uracil Glycosylase Inhibitor (UGI), Human 8-Oxidative Guanine DNA Glycoamylase (hOGG1), Human Alkylated Glycosylase Purine DNA glycosylase (hAAG), restriction endonuclease HpaII, and T7 endonuclease I (T7EndoI) were obtained from New England Biolabs (Beijing, China). T4 DNA ligase, phi29 DNA polymerase, and dNTPs were purchased from Fuzyces (Beijing, China). N-Methyl-porphyrin IX (NMM) was purchased from Frontier Science, Inc. (Logan, Utah, USA). Stock solutions of NMM were prepared in dimethyl sulfoxide (DMSO) and store...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a method for parallel determination of the activity of uracil-DNA glycosylase and endonuclease IV, application thereof and a reagent kit. When a target object is UDG, if UDG exists, U basic groups in a hairpin probe are removed, an AP locus is generated, the generated AP locus is cut through tool enzyme Endo IV, and a primer sequence containing free 3' terminal is released and used for initiating subsequent rolling circle amplification reaction (RCA); if UDG does not exist, the 3' terminals are closed in the hairpin probe, the RCA process can not be carried out. When a target object is Endo IV, if Endo IV exists, the RCA process is the same as that in UDG activity detection; if Endo IV does not exist, the 3' terminals are closed in the hairpin probe, and the RCA process can not be conducted. The hairpin probe can be used as a recognition probe of UDG and can also be used for precursor recognition probe of Endo IV, and accordingly design of the probe is simplified. The detection limits of UDG and Endo IV are reduced to 0.00017 U/mL and 0.11 U/mL respectively, and results are better than or the same as those of other label-free fluorescence methods.

Description

technical field [0001] The invention belongs to the technical field of medicine, and in particular relates to a method for parallel determination of uracil-DNA glycosylase and endonuclease IV activities, an application thereof and a kit. Background technique [0002] Uracil-DNA glycosylase (UDG) and endonuclease IV (EndoIV) are both U base removal repair (UBER) enzymes that play an important role in maintaining the integrity of the genome. UDG and EndoIV function synergistically in repairing U base damage in DNA. Specifically, UDG removes U base damage and creates an abasic (AP) site, which EndoIV then nicks. Abnormal activity of the UBER enzyme will inhibit the cellular response to U base damage, which will lead to various related diseases, including immunodeficiency syndrome, lymphoma, and Bloom syndrome. Studies have shown that the activity of UBER enzyme has become a promising biomarker for the above-mentioned diseases, and the detection method of UBER enzyme activity r...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/68C12Q1/44C12Q1/34
CPCC12Q1/682C12Q2521/531C12Q2521/307C12Q2525/301C12Q2531/125
Inventor 姜玮王磊吴玉姝
Owner SHANDONG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap