Probe related to colorectal cancer and application thereof

A colorectal cancer and probe technology, which is applied in the fields of molecular biology and oncology, can solve the problems such as the discomfort in the endoscopic detection process, the limitation of wide application, the low sensitivity of the detection results, and the unsuitability for colorectal cancer screening.

Inactive Publication Date: 2016-07-06
JIANGSU CANCER HOSPITAL +1
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Colonoscopy, double-contrast barium enema, and CT imaging are generally used in the diagnosis of colorectal cancer. However, these methods have certain defects in the early diagnosis of colorectal cancer in large populations: improper endoscopic detection or insufficient human experience may cause serious problems. Lead to misdiagnosis or missed diagnosis, and the discomfort of the endoscopic detection process further limits its wide application; imaging examination has certain limitations in the diagnosis of early colorectal cancer
At present, convenient and simple detection methods (such as fecal occult blood test FOBT, etc.) and some tumor marker detection (such as carcinoembryonic antigen CEA, etc.) have been used for the early diagnosis of colorectal cancer, due to the low sensitivity and low specificity of the detection results , these methods are not suitable for colorectal cancer screening in large populations

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Probe related to colorectal cancer and application thereof
  • Probe related to colorectal cancer and application thereof
  • Probe related to colorectal cancer and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Kit composition:

[0022] Digoxigenin-labeled hsa_circ_0003098 probe was synthesized by Guangzhou Exon Biotechnology Co., Ltd. (http: / / www.focofish.com / ) by chemical labeling method (5' tailing, intermediate labeling, chemical binding); probe The sequence is GACGACGCTGACCGTCCTGCCCCAC.

[0023] Hybridization kit (purchased from Guangzhou Exon Biotechnology Co., Ltd., article number: D-2966B, kit composition: SolutionA, SolutionB, Hybridization Buffer, BlockingBufferⅠ, WashingBuffer, Anti-DigoxinHRPConjugate, TSA-488, TSAamplificationBuffer, DAPI-AntifadeSolution) ;

[0024] Xylene;

[0025] 100%, 85%, 70% ethanol (v / v);

[0026] 4% paraformaldehyde (Kage Bio, article number: JQ-1);

[0027] rubber glue;

[0028] 0.1% DEPC water (Beiyuntian Bio, product number R0022);

[0029] 3%H 2 o 2 (v / v);

[0030] 0.15%H 2 o 2 (v / v);

[0031] PBS pH 7.0.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a probe related to colorectal cancer and application thereof. The probe has a sequence of GACGACGCTGACCGTCCTGCCCCAC and can be hybridized with hsa-circ-0003098. Because expression of the hsa-circ-0003098 in colorectal cancer tissues is higher than that in normal colorectal tissues, the probe has high application value on early diagnosis of the colorectal cancer and provides a support for early diagnosis and early treatment of the colorectal cancer clinically.

Description

technical field [0001] The invention belongs to the fields of molecular biology and oncology, and relates to a probe related to colorectal cancer and its application. Background technique [0002] Colorectal cancer (CRC) is one of the most common malignant tumors in the world, and its incidence rate ranks third among all tumors in the world. In Europe, America and other countries, the morbidity and mortality of colorectal cancer in all tumors account for about 8.6% and 8.8% respectively. From a global perspective, although China is an area with a low incidence of colorectal cancer, the incidence of colorectal cancer is increasing year by year. Early colorectal cancer lacks specific symptoms, and when patients seek treatment due to obvious clinical symptoms, they are often in the middle and advanced stages. About 25% of patients have metastases when they are first diagnosed, which seriously affects the treatment effect and prognosis. The high incidence of colorectal cancer ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6886
Inventor 竺明晨徐亦君严枫
Owner JIANGSU CANCER HOSPITAL
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap