Check patentability & draft patents in minutes with Patsnap Eureka AI!

EPO receptor and application of receptor in hepatocellular carcinoma with erythromelalgia accompanying polycythemia

A technology for polycythemia and tumor cell proliferation, applied in the field of tumor treatment, can solve problems such as hepatocellular carcinoma that have not been reported in the literature, and achieve a remarkable therapeutic effect.

Active Publication Date: 2016-11-09
SECOND MILITARY MEDICAL UNIV OF THE PEOPLES LIBERATION ARMY
View PDF3 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, there is no literature report on the relationship between EPO in liver cancer and patients with liver cancer with polycythemia, and there is no literature report on the treatment of hepatocellular carcinoma with polycythemia by blocking EPOR

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • EPO receptor and application of receptor in hepatocellular carcinoma with erythromelalgia accompanying polycythemia
  • EPO receptor and application of receptor in hepatocellular carcinoma with erythromelalgia accompanying polycythemia
  • EPO receptor and application of receptor in hepatocellular carcinoma with erythromelalgia accompanying polycythemia

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Example 1: High expression of EPO was detected in the serum and tumor tissue of liver cancer patients with polycythemia

[0037] In this study, liver cancer, paracancerous tissue and serum samples of liver cancer patients were obtained from Dongfang Hepatobiliary Surgery Hospital. 8 samples of liver cancer patients who were diagnosed with polycythemia were included in the study. Human EPO Platinum ELISA kit (eBioscience company) was used to test and verify the samples Serum EPO level was significantly higher than the control group and the upper limit of the reference value (35mU / mL), ELISA test results see figure 1 . The level of EPO mRNA in the control group and liver cancer tissues with polycythemia was detected by RT-PCR, and it was verified that the patients with elevated EPO detection level in serum had higher EPO expression level than the control group.

[0038] 1. The specific operation method of ELISA detection EPO is as follows:

[0039] (1) Collect the preop...

Embodiment 2

[0057] Example 2: Liver cancer cells with high expression of EPOR have stronger characteristics of tumor stem cells

[0058] Liver cancer samples from patients with high EPOR expression were taken for treatment, and then subcutaneously inoculated into nude mice to construct a PDX model. PDX tumor cells were isolated from the primary generation, and EPOR-positive and negative liver cancer cells in PDX model mice were enriched by magnetic separation technology, and EPOR was detected by flow cytometry. The expression of Epcam in positive cells was higher than that in control cells ( image 3 ). RT-PCR was used to detect the expression levels of tumor precursor cell markers in the cells of the two groups, and it was found that the expression levels of tumor precursor cell markers OCT4, SOX9, LGR5, NANOG and CD133 in EPOR highly expressed cells were significantly higher than those in the EPOR negative cell group ( Figure 4 ).

[0059] The steps of primary isolation and magnetic ...

Embodiment 3

[0089] Example 3: Construction of Ad-EPOR-Fc and verification of its inhibitory effect on the proliferation of liver cancer cells

[0090] Using adenovirus as a vector, construct an adenovirus Ad-EPOR-Fc that expresses the fusion protein of the recombinant soluble EPO receptor Fc segment, and the construction method of the adenovirus recombinant plasmid is as follows:

[0091] 1. Primer design and synthesis

[0092] 1.1PCR primer sequence

[0093] epr1-GCGAATTCGCCACCATGGACCAC (SEQ ID NO: 17)

[0094] epr2-GAGACAAAGGGAGCCGACCTGGGGCCAGAGGGACGCCCCGAGGTGGTCCATGGTGGCG (SEQ ID NO: 18)

[0095] epr3-GTCGGCTCCCTTTGTCTCCTGCTCGCTGGGGCCGCCTGGGCGCCCCCGCCTAACCTCC (SEQ ID NO: 19)

[0096] epr4-GGGCCGCCAGCAAGGCCGCTTTGCTCTCGAACTTGGGGTCCGGGAGGTTAGGCGGGGG (SEQ ID NO: 20)

[0097] epr5-CCTTGCTGGCGGCCCGGGGGCCCGAAGAGCTTCTGTGCTTCACCGAGCGGTTGGAGGA (SEQ ID NO: 21)

[0098] epr6-CCCACCCCAGCGCTCGCCGCTTCCTCCCAGAAACACACCAAGTCCTCCAACCGCTCGG (SEQ ID NO: 22)

[0099] epr7-GAGCGCTGGGGTGGGCCCGGGCAACTACA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of tumor treatment, in particular to application of an EPO / EPOR signal path inhibiting or blocking agent in the preparation of liver cancer drugs for treating erythromelalgia accompanying polycythemia. It is found that the erythromelalgia accompanying polycythemia caused by EPO production in the hepatocellular carcinoma has the effect of promoting progress of the hepatocellular carcinoma, and the invention provides an EPO / EPOR signal inhibiting or blocking path capable of serving as a new therapeutic target of the hepatocellular carcinoma. A recombinant adenovirus Ad-EPOR-Fc and a recombinant protein EPOR-Fc can remarkably inhibit cell proliferation and lower the p-stat3 expression level, have no obvious toxicity for normal liver cells, the recombinant protein has the more remarkable treating effect on the hepatocellular carcinoma with the erythromelalgia accompanying polycythemia compared with other similar commercialized receptors, and a new thought and a method are provided for hepatocellar carcinoma treatment.

Description

technical field [0001] The invention relates to the technical field of tumor treatment, in particular to an EPO receptor (EPOR) and its application in hepatocellular carcinoma with polycythemia. Background technique [0002] Liver cancer is a common clinical malignant tumor, among which hepatocellular carcinoma (Hepatocellular Carcinoma, HCC) is the main pathological type. According to data released by the World Health Organization (WHO) in 2014, liver cancer is the fifth most common tumor in men and the ninth most common tumor in women. According to estimates, there were 782,000 new cases of liver cancer in the world in 2012, and new cases in China alone accounted for more than 50% of the total (Rautou, P.E., et al., Autophagy in liver diseases. J Hepatol, 2010.53(6): p. 1123-34.). In recent years, due to the increase in the incidence of basic diseases such as HCV infection and steatohepatitis, the incidence of liver cancer is on the rise. The etiology of liver cancer is...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K45/00A61K38/17A61P35/00
CPCA61K38/17A61K45/00A61P35/00A61K38/1793
Inventor 王红阳文文柯仕忠陈淑桢董子慧唐亮凌妍
Owner SECOND MILITARY MEDICAL UNIV OF THE PEOPLES LIBERATION ARMY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More