Method for detecting escherichia coli in coastal seawater
A technology of Escherichia coli and a detection method, which is applied in the field of coastal Escherichia coli detection, can solve the problems of inability to quantify seawater, consume large manpower and material resources, and take a long time for Escherichia coli, overcome the inability to measure unculturable Escherichia coli, improve accuracy, The effect of shortening the detection time
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0026] The present invention will be described in detail below in combination with specific embodiments.
[0027] A suction filtration system was used to trap bacteria in seawater on a microporous membrane with a pore size of 0.22 μm, and the DNA on the membrane was extracted with the E.N.Z.A.TM Water DNA Kit kit (Omega, USA). For specific steps, refer to the kit manual.
[0028] The primers designed for Escherichia coli alkaline phosphatase (phoA) gene specific to Escherichia coli, the target fragment size is about 622bp, the primer information is as follows:
[0029] Upstream primer: TACAGGTGACTGCGGGCTTATC
[0030] Downstream primer: CTTACCGGGCAATACACTCACTA
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
