Check patentability & draft patents in minutes with Patsnap Eureka AI!

Method for detecting escherichia coli in coastal seawater

A technology of Escherichia coli and a detection method, which is applied in the field of coastal Escherichia coli detection, can solve the problems of inability to quantify seawater, consume large manpower and material resources, and take a long time for Escherichia coli, overcome the inability to measure unculturable Escherichia coli, improve accuracy, The effect of shortening the detection time

Inactive Publication Date: 2016-11-30
TIANJIN UNIV
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] In order to solve the problems in the prior art, the present invention provides a detection method for Escherichia coli in coastal seawater, which solves the problem of the time-consuming detection of Escherichia coli based on the selective culture medium method in the prior art, the large consumption of manpower and material resources, and the inability to quantify the presence of Escherichia coli in seawater. The problem with non-culturable E. coli

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting escherichia coli in coastal seawater
  • Method for detecting escherichia coli in coastal seawater
  • Method for detecting escherichia coli in coastal seawater

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0026] The present invention will be described in detail below in combination with specific embodiments.

[0027] A suction filtration system was used to trap bacteria in seawater on a microporous membrane with a pore size of 0.22 μm, and the DNA on the membrane was extracted with the E.N.Z.A.TM Water DNA Kit kit (Omega, USA). For specific steps, refer to the kit manual.

[0028] The primers designed for Escherichia coli alkaline phosphatase (phoA) gene specific to Escherichia coli, the target fragment size is about 622bp, the primer information is as follows:

[0029] Upstream primer: TACAGGTGACTGCGGGCTTATC

[0030] Downstream primer: CTTACCGGGCAATACACTCACTA

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for detecting escherichia coli in coastal seawater. The method comprises the steps of extracting escherichia coli DNAs, amplifying target fragments, constructing a standard plasmid template, establishing a Q-PCR quantitative standard curve and measuring the number of escherichia coli in an environmental sample. Compared with current detection based on a selective culture method, the method has the advantages that first detection time is shortened from 10-12 d of the original method to 1 d, and is only 3-4 h on the conditions that the standard curve is finished; the problem that escherichia coli cannot be measured in the original method is solved, and the identification accuracy is improved.

Description

technical field [0001] The invention relates to the technical field of detection of common bacteria, in particular to a detection method for near-coast Escherichia coli. Background technique [0002] In recent years, with the rapid development of my country's economy and the continuous improvement of people's living standards, near-shore sea water, especially sea bathing beaches, has become an important place for people's leisure activities in summer. However, due to the imperfection of my country's urban sewage treatment system, a lot of untreated sewage is directly discharged into offshore waters, which poses a great threat to public health and safety of bathing beaches. Escherichia coli, classified in the Enterobacteriaceae family, belongs to the genus Escherichia. It is closely related to human intestinal diseases, and is used as a hygienic indicator of fecal pollution in drinking water, food, and recreational water in hygiene. At the same time, due to the similar surv...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12Q1/10C12R1/19
CPCC12Q1/6851C12Q2531/113C12Q2545/113
Inventor 何艺科商君阳汪光义
Owner TIANJIN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More