Systems and methods for clonal replication and amplification of nucleic acid molecules for genomic and therapeutic applications

A technique for nucleic acid molecule and rolling circle amplification, applied in the field of replication and amplification of nucleic acid molecule

Inactive Publication Date: 2017-02-22
REDVAULT BIOSCI
View PDF10 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Another problem associated with forming circles by joining the ends of DNA fragments together is that larger DNA fragments must be further diluted to achieve reasonable efficiency of forming intramolecular circles compared to smaller DNA fragments.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Systems and methods for clonal replication and amplification of nucleic acid molecules for genomic and therapeutic applications
  • Systems and methods for clonal replication and amplification of nucleic acid molecules for genomic and therapeutic applications
  • Systems and methods for clonal replication and amplification of nucleic acid molecules for genomic and therapeutic applications

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0116] Demonstration of size independence for dumbbell-shaped templates containing two distinct hairpin structures. Use a set of primers (i.e. forward: 5'-GGA TCC GAA TTC GCT GAA GCC AGT TAC CTT CG and reverse: 5'-GGA TCC GAA TTCAGC CCT CCC GTA TCG TAG TT) to amplify the sample DNA, i.e. the pUC18 vector to A product with 425 base pairs was obtained. The 5'-end of each primer contains a BamHI restriction endonuclease site and an EcoRI restriction endonuclease site. The PCR product was then digested with EcoRI to provide a 5'-AATT overhang and purified with the QIAquick PCR purification kit. A 5'-AATT overhang is generated by heating to 50°C followed by cooling to allow the oligonucleotides to self-anneal at the underlined sequence to form a hairpin structure 1 (5'-AATT GCGAG TTG CGA GTT GTA AAA CGA CGG CCA GT CTCGC ). The loop structure contains the M13 universal primer sequence. The hairpin structure 1 and pUC18 PCR products were combined at a molar ratio of 10:1, res...

Embodiment 2

[0120] Genomic DNA can also be used as a starting sample. By way of example and without limitation, purified genomic DNA from HapMap sample NA18507 can be obtained from Coriell Cell Repositories and sheared using standard next-generation sequencing methods (i.e., using a Covaris E210R device), then Fragments were size selected in size increments of 0.5 kb, 1.0 kb, 2.5 kb, 5.0 kb, 7.5 kb, and 10.0 kb. Similar to above, DNA samples can be fragmented to generate DNA fragments of different sizes, the starting number of fragments quantified, hpA / hpB ligated using the same conditions, and enriched for hpA-fragment-hpB dumbbell templates . Enrichment factors will be determined using double-label fluorescence microscopy to count co-localized fluorescent signals and comparing this number to the total number of fluorescent signals. The Nikon Eclipse Microscopy Analysis Tool can perform many analyses, including intensity measurements, colocalization of multiple fluorescent signals, and...

Embodiment 3

[0124] Dumbbell templates for replication are also formed from large fragmented dA-tailed genomic DNA. Here, hairpins were ligated by TA cloning and blunt end ligation. TA cloning methods are well integrated into most current NGS platforms. We have engineered hairpin 2 (HP2) (5'- / Phos- CTTTTTTCTTTCTTTTCTGGGTTGCGTCTGTTCGTCT AGAAAAGAAAGAAAAAG T). Human genomic DNA (500ng) was fragmented using Covaris G-tubes to achieve a tightly defined population of fragment lengths, such as Figure 5 Lanes 1 and 2 are shown. This genomic DNA was then end-repaired and dA-tailed using the End Preparation Module of the NEBNext Ultra DNA Library Prep Kit. HP2 was self-annealed similarly to HP1 and ligated to repaired genomic DNA using Blunt / TA Ligase Mater Mix (5:1 molar ratio). Excess HP2 and unligated genomic DNA were removed using exonuclease III and VII.

[0125] The resulting dumbbell-shaped template was purified using Qiaex ii beads and an RCR reaction using a unique primer (5'-AAAA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention provides for methods, reagents, apparatuses, and systems for the replication or amplification of nucleic acid molecules from biological samples. In one embodiment of the invention, the nucleic molecules are isolated from the sample, and subjected to fragmenting and joining using ligating agents of one or more hairpin structures to each end of the fragmented nucleic molecules to form one or more dumbbell templates. The one or more dumbbell templates are contacted with at least one substantially complementary primer attached to a substrate, and subjected to rolling circle replication or rolling circle amplification. The resulting replicated dumbbell templates or amplified dumbbell templates are used in numerous genomic applications, including whole genome de novo sequencing; sequence variant detection, structural variant detection, determining the phase of molecular haplotypes, molecular counting for aneuploidy detection; targeted sequencing of gene panels, whole exome, or chromosomal regions for sequence variant detection, structural variant detection, determining the phase of molecular haplotypes and / or molecular counting for aneuploidy detection; study of nucleic acid - nucleic acid binding interactions, nucleic acid - protein binding interactions, and nucleic acid molecule expression arrays; and testing of the effects of small molecule inhibitors or activators or nucleic acid therapeutics.

Description

technical field [0001] Embodiments of the invention relate generally to the field of replication and amplification of nucleic acid molecules. More specifically, certain embodiments of the invention relate to replicating DNA molecules from biological samples using rolling circle replication. Other embodiments of the invention relate to the amplification of DNA molecules from biological samples using rolling circle amplification. Certain embodiments of the invention can be used to characterize sequence variation in genomes derived from biological samples. Certain embodiments of the invention can be used to perform molecular enumeration of whole chromosomes or portions thereof derived from biological samples. Certain embodiments of the invention can be used to characterize haplotype structure in genomes derived from biological samples. Certain embodiments of the invention may find application in sample preparation and analysis in genomic sciences, biomedical research, diagnost...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/68
CPCC12Q1/6844C12Q2521/501C12Q2525/301C12Q2531/125C12Q2522/101C12Q2525/155C12Q2525/179C12Q2521/513C12Q2521/507C12Q2521/519C12Q1/6853C12Q1/6855C12Q1/6874
InventorM·L·梅兹可C·A·威尔
OwnerREDVAULT BIOSCI