A method for targeted editing of the mitochondrial genome using CRISPR/Cas9

A mitochondrial genome and mitochondrial gene technology, which can be used in viruses/phages, biochemical equipment and methods, and the introduction of foreign genetic material using vectors, which can solve problems such as cell growth stagnation, energy production obstruction, and protein translation inhibition

Active Publication Date: 2019-12-10
FUJIAN NORMAL UNIV
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Reducing the expression of PNPASE will affect the level of RNA into the mitochondria, thereby affecting the synthesis of proteins required to maintain the electron transport chain
At the same time, unprocessed mitochondrial RNA builds up, protein translation is inhibited, and energy production is hampered, which leads to stalled cell growth

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for targeted editing of the mitochondrial genome using CRISPR/Cas9
  • A method for targeted editing of the mitochondrial genome using CRISPR/Cas9
  • A method for targeted editing of the mitochondrial genome using CRISPR/Cas9

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] Example 1 Construction of MitoCRISPR plasmid vector

[0051] First, we added the 3'UTR signal of the mitochondrial localization signal MRPS12 gene after the U6 promoter. The plasmid of Mito-U6-RP-BbsI-3'UTR was constructed. Then remove the nuclear localization signal before the Cas9 gene, add the mitochondrial localization signal of Cox8A, that is, the MLS sequence, and construct the plasmid of Mito-U6-RP-BbsI-3'UTR-CBh-MLS-Cas9. Then add the EGFP gene after Cas9 to observe the transfection efficiency. At the same time, the 3'UTR signal of MRPS12 was added after the Cas9 expression frame to stabilize the entire structure of the expressed Cas9 mRNA. Finally, the Mito-U6-RP-BbsI-3'UTR-CBh-MLS-Cas9-2A-GFP-3'UTR (MitoCRISPR) plasmid vector, namely pMitoCRISPR1 ( figure 1 a).

[0052] Specifically:

[0053] (1) The introduction of elements used to control the expression of sgRNA: After the U6 promoter of the PX459 vector, the mitochondrial localization signal RP sequenc...

Embodiment 2

[0063] Example 2 Gene Knockout for the Mitochondrial 12sr RNA Gene Locus

[0064] The specific method for constructing a mitochondrial gene knockout vector targeting the mitochondrial 12srRNA gene locus is as follows:

[0065] Select the pMitoCRISPR1 plasmid as the backbone to construct the mitochondrial gene knockout recombinant plasmid vector. The pMitoCRISPR1 plasmid contains the basic elements of the CRISPR system, namely the Cas9 protein gene and the elements that control the expression of sgRNA in mitochondria, including the U6 promoter, RP sequence and 3'UTR sequence . The U6 promoter is used to promote the expression of sgRNA. The 3'UTR sequence helps stabilize the expressed sgRNA so that it can come out of the nucleus and locate on the mitochondrial outer membrane; the input sequence at the 5' end of the RNA-RP sequence helps the RNA enter the mitochondria. Once the 3'UTR sequence helps RNAs appear on the mitochondrial surface, a second trafficking sequence (RP seque...

Embodiment 3

[0080] Example 3 Mitochondrial gene knockout targeting the mitochondrial cytb gene locus

[0081] In this example, the cytb gene on the mitochondrial genome is selected and knocked out, and the specific steps are as follows: the annealing reaction is performed using the method described in Example 2.

[0082] The sgRNA target sequence of Cytb is: ATCCCGTTTCGTGCAAGAAT; the RP sequence is: TCTCCCTGAGCTTCAGGGAG; the Cytb gene sgRNA primer sequence for insertion into the Bbs I restriction site of pMitoCRISPR1 plasmid is as follows: Mito-KO-H-Cytb-F: CACCGTCTCCCCTGAGCTTCAGGGAGATCCCGTTTCGTGCAAGAAT;

[0083] Mito-KO-H-Cytb-R:AAACATTCTTGCACGAAACGGGATCTCCCTGAAGCTCAGGGAGAC;

[0084] The mitochondrial Cytb gene knockout vector pMitoCRISPR1-KO-Cytb was constructed using the method described in Example 2, and verified by sequencing. Next, the plasmid vector was transfected into 293T cells by the method described in Example 2, and after 3 days, the efficiency of the plasmid vector for mito...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A method of performing targeted editing on a mitochondrial genome by utilizing CRISPR / Cas9 is provided. The method includes steps of constituting a MitoCRISPR vector of the mitochondrial genome; inserting a mitochondrion specific sgRNA into the MitoCRISPR vector to constitute a mitochondrion gene knockout or modified vector; and transferring the mitochondrion gene knockout or modified vector into a human or animal cell, thus achieving the objective of editing the mitochondrial genome of the human or animal cell. Cas9 protein and the sgRNA elements are transformed by the method so that the Cas9 protein and sgRNA elements enter a mitochondrion and target on a corresponding gene of the genome to perform gene knockout and modification to hope to clear mutant DNA in the genome, and therefore a plurality of mitochondrial diseases are expected to be treated.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a method for targeted editing of mitochondrial genome by using CRISPR / Cas9 technology. Background technique [0002] Mitochondria are important organelles of eukaryotic cells that generate most of the energy required by cells. In addition to providing energy, mitochondria are also involved in a variety of cellular functions, including cell cycle and growth control, signal transmission, cell differentiation, regulation of cell death, etc. Mitochondrial genome is a double-stranded circular genome, ie mtDNA, its mutation will affect various tissues and organs, and eventually lead to various diseases. In most cases, mutant mtDNA coexists with wild-type mtDNA, which is called mtDNA heteroplasmy. When the proportion of the mutant genome exceeds 80%, the clinical symptoms of some mitochondrial diseases can be shown. Common mitochondrial diseases include mitochondrial myopathy...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/85
CPCC12N15/85C12N2800/107C12N2800/80
Inventor陈骐沈阳坤
OwnerFUJIAN NORMAL UNIV