A kit for detecting systemic lupus erythematosus (SLE) and its detection method
A systemic technology for lupus erythematosus, applied in biochemical equipment and methods, measuring devices, peptide sources, etc., can solve the problem of not identifying reliable diagnostic markers of pathophysiological manifestations
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0018] The peripheral blood mononuclear cell specimens of 20 cases of systemic lupus erythematosus patients and 20 cases of healthy control groups were collected respectively; total cell protein extraction and protein concentration determination were performed on each of the peripheral blood mononuclear cell samples; After the protein is digested by protease, it is labeled with relative and absolute quantitative isobaric tags to obtain relative and absolute quantitative isobaric tag multiple-labeled polypeptides; the polypeptides are separated by strong cation exchange and reversed-phase liquid chromatography , and then carried out tandem mass spectrometry identification and relative quantitative analysis to obtain the staged protein expression differential map model of systemic lupus erythematosus. Through phenotypic identification, the final analysis obtained two proteins, SERPINA6 and C4BPA, with significant differential expression, which can be used as biological Detection ...
Embodiment 2
[0021] The acquisition of embodiment 2 aptamers
[0022] Using SELEX technology, the aptamer specifically binding to C4BPA protein was screened, and its sequence is as follows: TACGTAGAATGACTCGTGAG(N)35CAGTACGATGGATGCAGTGA
[0023] C4BPA-1:
[0024] TACGTAGAATGACTCGTGAGCTCCACCAACCTCTTCTACTACATATTCAAAACCAGTACGATGGATGCAGTGA
[0025] C4BPA-2:
[0026] TACGTAGAATGACTCGTGAGTCTCTCTCATTCATCCTCAAAAATACTATTATCACTCAGTACGATGGATGCAGTGA
[0027] C4BPA-3:
[0028] TACGTAGAATGACTCGTGAGAATTTAATCTAAAACCCATATTTTTCCACCACATTACAGTACGATGGATGCAGTGA
[0029] C4BPA-4:
[0030] TACGTAGAATGACTCGTGAGCCCATCTATCCTCCATTTCATTTACTAACCCCAAACAGTACGATGGATGCAGTGA
[0031] C4BPA-5:
[0032] TACGTAGAATGACTCGTGAGCACCTAAACATACTATACTTTAATTTAACTCCACTCAGTACGATGGATGCAGTGA
[0033] C4BPA-6:
[0034] TACGTAGAATGACTCGTGAGCTTTATCAAACAACACTTCATTTTCCCAATATTATCAGTACGATGGATGCAGTGA
[0035] C4BPA-7:
[0036] TACGTAGAATGACTCGTGAGATCATCACTCCACCCTACCCTTCCTCCCCAAACAACAGTACGATGGATGCAGTGA
[0037] C4BPA-8:
[0038] TACGTAG...
Embodiment 3
[0049] Example 3 The performance measurement of protein binding suitable gametes
[0050] Based on the property of graphene oxide oxidation to adsorb single-stranded DNA, a method for verifying the affinity of oligonucleotide aptamers was constructed. A fixed concentration of C4BPA protein target (1 μM) was incubated with a series of candidate oligonucleotide aptamers corresponding to different concentrations (10, 25, 50, 75, 100, 150, 200 uM), with a total volume of 300 uL, Incubate at 37°C in the dark for 2 hours, and use BB buffer instead of the target as a negative control group. After incubation and binding, GO with the optimal dosage ratio was added to adsorb the aptamer that was not bound to the target. After centrifugation, the fluorescence intensity emitted by the supernatant at 520nm under 490nm excitation was measured with an F-7000 fluorescence photometer. Use dark treatment. Taking the fluorescence intensity of the experimental group relative to the negative con...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


