Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for knocking out EGFRwt and EGFRvIII simultaneously from glioblastoma multiforme

A technology for glioblastoma and glioma cells, applied in the field of DNA recombination, can solve the problem that EGFRwt cannot be blocked or inhibited at the same time, and achieve the effect of inhibiting the occurrence and development of tumors

Active Publication Date: 2017-05-31
GENERAL HOSPITAL OF TIANJIN MEDICAL UNIV
View PDF0 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] In order to solve the problem that the existing technical means cannot simultaneously block or inhibit the expression of EGFRwt and EGFRvIII, the present invention proposes a method for simultaneously knocking out EGFRwt and EGFRvIII in glioblastoma

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for knocking out EGFRwt and EGFRvIII simultaneously from glioblastoma multiforme
  • Method for knocking out EGFRwt and EGFRvIII simultaneously from glioblastoma multiforme
  • Method for knocking out EGFRwt and EGFRvIII simultaneously from glioblastoma multiforme

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0020] The present invention will be further described below in conjunction with the accompanying drawings and embodiments.

[0021] 1. Cas9 and sgRNA lentivirus design and packaging

[0022] The Cas9 plasmid was purchased from addgene, and the EGFR sgRNA was designed from http: / / crispr.mit.edu / according to the EGFR sequence (NM_005228). The sequence with the highest score was taken, located on chromosome 17: AGATCCCGTCCATCGCCACT, and the sgRNA sequence was connected using the GV371 plasmid.

[0023] Cell preparation:

[0024] 1) Discard the old culture medium, add 5 ml sterilized PBS solution, shake gently, wash the cell growth surface, then discard the PBS solution.

[0025] 2) Digest 293T cells (ATCC) in logarithmic growth phase with 2 ml trypsin (Gibco, Thermo Fisher Scientific, USA).

[0026] 3) Adjust the cell density to 5×10 with medium containing 10% serum 6 Cells / 10ml, reseeded in 100 mm cell culture dish, 37°C, 5% CO 2 Continue to culture until the cell density...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for knocking out EGFRwt and EGFRvIII simultaneously from glioblastoma multiforme and relates to the recombinant DNA technology. The target site of sgRNA in an EGFR gene is on exon 17 of the EGFR gene, and is a gene sequence expressing a transmembrane region of the EGFR. According to the method for constructing Cas9 and sgRNA lentiviruses and infecting the glioblastoma multiforme with the lentiviruses, EGFRwt and EGFRvIII can be knocked out simultaneously from the glioblastoma multiforme. EGFRwt and EGFRvIII can be knocked out simultaneously and stably from the glioblastoma multiforme with the method, and occurrence and development of tumor can be inhibited effectively after knockout. The sgRNA is expected to be applied to novel drugs for treating EGFR amplification type and EGFRvIII mutant type glioblastoma multiforme.

Description

technical field [0001] The invention relates to DNA recombination technology, more specifically a method for simultaneously knocking out EGFRwt and EGFRvIII in glioblastoma. Background technique [0002] Glioma is the most common primary tumor in the human brain, and glioblastoma is its most malignant type. Despite the use of advanced technology surgical treatment and chemoradiotherapy, the average survival period of glioblastoma remains in the About 14 months, the treatment of glioblastoma is a world problem. 40-60% of patients with glioblastoma have EGFR amplification, and about 25% have EGFR type III mutation (EGFRvIII), both of which can enhance EGFR activity, enhance tumor malignancy and reduce patient prognosis. Currently, EGFR monoclonal antibodies (mAbs) and small molecule inhibitors (TKIs) targeting EGFR amplification and mutant therapy have been successful in lung cancer, but because of the blood-brain barrier, mAbs and TKIs cannot reach glioblasts tumors, and m...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/867C12N5/10
CPCC12N15/1138C12N15/86C12N2310/10C12N2740/15043C12N2800/107C12N2800/80
Inventor 康春生黄凯王蕴非王琦雪杨超
Owner GENERAL HOSPITAL OF TIANJIN MEDICAL UNIV