Method for knocking out EGFRwt and EGFRvIII simultaneously from glioblastoma multiforme
A technology for glioblastoma and glioma cells, applied in the field of DNA recombination, can solve the problem that EGFRwt cannot be blocked or inhibited at the same time, and achieve the effect of inhibiting the occurrence and development of tumors
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0020] The present invention will be further described below in conjunction with the accompanying drawings and embodiments.
[0021] 1. Cas9 and sgRNA lentivirus design and packaging
[0022] The Cas9 plasmid was purchased from addgene, and the EGFR sgRNA was designed from http: / / crispr.mit.edu / according to the EGFR sequence (NM_005228). The sequence with the highest score was taken, located on chromosome 17: AGATCCCGTCCATCGCCACT, and the sgRNA sequence was connected using the GV371 plasmid.
[0023] Cell preparation:
[0024] 1) Discard the old culture medium, add 5 ml sterilized PBS solution, shake gently, wash the cell growth surface, then discard the PBS solution.
[0025] 2) Digest 293T cells (ATCC) in logarithmic growth phase with 2 ml trypsin (Gibco, Thermo Fisher Scientific, USA).
[0026] 3) Adjust the cell density to 5×10 with medium containing 10% serum 6 Cells / 10ml, reseeded in 100 mm cell culture dish, 37°C, 5% CO 2 Continue to culture until the cell density...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com