Primers for identifying soybean male sterile line and method thereof
A male sterile line, soybean technology, applied in the field of genetic engineering, can solve the problems of difficult application, difficult to accurately identify soybean, and few molecular marker technologies for soybean male sterility, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0020] 1. Materials
[0021] The methods used in this example are conventional methods known to those skilled in the art unless otherwise specified, and the reagents and other materials used are all commercially available products unless otherwise specified.
[0022] 2. Method
[0023] 2.1 Extraction of soybean DNA
[0024] The F2 material from the heterozygous fertile soybean planted by field hybridization was used as the sample to be tested, and the sterile meat pods of the male sterile soybean plants were used as the sterile control. The fertile beans were used as a fertile control, and the DNA of the sample to be tested, the sterile control and the fertile control were extracted by the CTAB method or the SDS method.
[0025] 2.2 PCR amplification
[0026] Design specific amplification primers, and carry out PCR amplification, described specific amplification primers are as shown in SEQ ID NO.1, SEQ ID NO.2:
[0027] SEQ ID NO.1: Upstream primer: ATCATCTCACTCTGCGTGTA
...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com