Primers for identifying soybean male sterile line and method thereof

A male sterile line, soybean technology, applied in the field of genetic engineering, can solve the problems of difficult application, difficult to accurately identify soybean, and few molecular marker technologies for soybean male sterility, etc.

Active Publication Date: 2017-06-20
ANHUI AGRICULTURAL UNIVERSITY
View PDF4 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The second category is male infertility and female infertility. This type of infertility is difficult to apply in genetic breeding and has no practical significance
[0006] The identification method of soybean male sterility mainly relies on phenotypic identification at present, and it is difficult to accurately identify soybeans in the early growth stage
And if it can be identified at the molecular level, it is undoubtedly the most efficient and accurate method, but currently there are few effective patents for molecular marker technology for male sterility in soybeans, and the present invention is just the research achievement of this aspect

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primers for identifying soybean male sterile line and method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] 1. Materials

[0021] The methods used in this example are conventional methods known to those skilled in the art unless otherwise specified, and the reagents and other materials used are all commercially available products unless otherwise specified.

[0022] 2. Method

[0023] 2.1 Extraction of soybean DNA

[0024] The F2 material from the heterozygous fertile soybean planted by field hybridization was used as the sample to be tested, and the sterile meat pods of the male sterile soybean plants were used as the sterile control. The fertile beans were used as a fertile control, and the DNA of the sample to be tested, the sterile control and the fertile control were extracted by the CTAB method or the SDS method.

[0025] 2.2 PCR amplification

[0026] Design specific amplification primers, and carry out PCR amplification, described specific amplification primers are as shown in SEQ ID NO.1, SEQ ID NO.2:

[0027] SEQ ID NO.1: Upstream primer: ATCATCTCACTCTGCGTGTA

...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to the technical field of gene engineering, and provides primers for identifying a soybean male sterile line and a method thereof. The primers are disclosed as SEQ ID NO.1 and SEQ ID NO.2. The method comprises the following steps: carrying out PCR (polymerase chain reaction) amplification and BstXI enzyme digestion on the template soybean genome DNA by using the primers; and judging the soybean is the male sterile line if the product only contains one 472bp strip, and judging the soybean is the male fertile line if the product comprises 266bp and 202bp. On the basis of detecting that the soybean male-sterile character is controlled by a pair of recessive single genes, the invention develops a codominant molecular marker for identifying the soybean male sterile line, and provides the primers for identifying the soybean male sterile line and the method thereof. The primers and method can perform efficient accurate identification on the soybean fertility and genotype in any period in the soybean breeding process, thereby providing a new way for molecular identification of the soybean male sterile line.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a primer for identifying soybean male sterile lines and a method thereof. Background technique [0002] Conventional hybridization is the most commonly used method in soybean breeding, but this method advocates selecting the best from the best, and one of the parents is often a local excellent variety. In the long run, the relatives of the varieties used in production will be very close, which will inevitably lead to a trend in the genetic basis. Therefore, it has been unable to achieve the high-standard breeding goals of high quality, high yield, multiple resistance and broad genetic basis. Therefore, people have gradually paid attention to the use of recurrent selection for population improvement to solve the problem of narrow genetic basis in conventional hybridization. [0003] As a self-pollinating crop, soybean has small flower organs, difficult hybridization a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6895C12Q2600/13
Inventor 王晓波李冬冬韩家俊程姣姣林益达龚劲栋邱丽娟李佳佳
Owner ANHUI AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products