Check patentability & draft patents in minutes with Patsnap Eureka AI!

Method for fixed point knock-out of second exon of rice OsPDCD5 gene by using CRISPR/Cas9 system

A targeted knockout and exon technology, applied in genetic engineering, chemical instruments and methods, botany equipment and methods, etc., can solve the problem of death of transgenic regenerated plants

Active Publication Date: 2017-07-11
FUDAN UNIV
View PDF4 Cites 15 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The expression level of OsPDCD5 in mature tissues was significantly higher than that in young tissues, and the overexpression of OsPDCD5 would lead to the death of transgenic regenerated plants

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for fixed point knock-out of second exon of rice OsPDCD5 gene by using CRISPR/Cas9 system
  • Method for fixed point knock-out of second exon of rice OsPDCD5 gene by using CRISPR/Cas9 system
  • Method for fixed point knock-out of second exon of rice OsPDCD5 gene by using CRISPR/Cas9 system

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1 Knockout and application of the second exon of rice OsPDCD5 gene

[0036] 1. Construction of pBWA(V)H-cas9-PDCD5.2 vector

[0037] (1) According to the CRISPR / Cas9 system, one strand in the double-stranded target sequence has the following structure: 5'-N x-NGG-3', N represents any one of the four bases A, G, C, T, 14≤X≤30, select the second exon of OsPDCD5 gene (nucleotide sequence such as SEQ ID NO.1 As shown, the amino acid sequence of the protein encoded by it is shown in SEQ ID NO.3; as figure 1 Shown) in the 23bp sequence that meets the above requirements (shown as SEQ ID NO.2) as the target sequence;

[0038] Use primer yjstgt (+): cagtGGTCTCaggcacccagagttggaagcta and yjstgt (-): cagtGGTCTCaaaacgatagcttccaactctg to amplify the target sequence of 20bp in the second exon of OsPDCD5 gene (the nucleotide sequence is: accccagagttggaagctatc, as shown in SEQ ID NO.9), the amplification The PCR product is: cagtGGTCTCaggcacccagagttggaagctatcgttttGAGACCagtg, a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for fixed point knock-out of the second exon of rice OsPDCD5 gene by using a CRISPR / Cas9 system. The method comprises the following steps: selecting a target fragment in the second exon region of the rice OsPDCD5 gene, constructing a plant CRISPR / Cas9 recombinant vector, introducing the plant CRISPR / Cas9 recombinant vector to rice calluses through an Agrobacterium infection technology, carrying out regeneration to form seedlings, shearing double strands of the second exon of the OsPDCD5 gene under the combined action of guide RNA and Cas9 nuclease, and realizing random insertion or random deletion of the target gene fragment through the self DNA repairing function of cells. Nine strains with the target fragment having point mutation are obtained through a PCR amplification sequencing technology, and pass phenotype identification, so the purpose of the increase of the plant height and the yield of rice is realized. The method provides an efficient breeding way for cultivating high-yield and high-quality rice varieties.

Description

technical field [0001] The invention relates to a method for targeted knockout of the second exon target sequence of the rice OsPDCD5 gene to obtain a rice mutant strain with improved rice plant type and panicle type, and belongs to the technical field of plant genetic engineering. Background technique [0002] Rice is one of the most important food crops in the world, and about 2 / 3 of the world's population uses rice as a staple food. In the case of gradually decreasing arable land, in order to meet the growing population's demand for food, it is of great significance to increase the unit yield of rice. Traditional hybrid breeding has played a key role in the continuous improvement of rice yield in my country, but there are problems such as low seed production efficiency, high labor intensity, long breeding time, and unstable seed yield. However, the current plant genome engineering technology has solved the problem. these puzzles. For example, zinc finger nuclease (ZFN), ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/82A01H5/00
CPCC07K14/415C12N15/8216C12N15/8261
Inventor 罗小金董贤欣杨金水孙凡姜玲
Owner FUDAN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More