Improved preparation method of adenylate cyclase
A technology of adenylyl cyclase and nucleotide sequence, applied in biochemical equipment and methods, botany equipment and methods, enzymes, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] 1. Optimize the codon of the ADCY2 gene. The optimized codon and nucleotide sequence are shown in SEQ ID NO: 1, and the expression-assisted sequence B-tag is added to the N segment of the ADCY2 gene after codon optimization, such as Shown in SEQ ID NO: 2; the helper expression sequence is: (5'-ATCCAGCGTACTCCAAAGATTCAGGTTTACTCACGTCATCCAGCAGAGAATGGAAAGTCAATTTCCTGAATTGCTAT-3'); 10×his tag is added to the C-terminus, as shown in SEQ ID NO: 3; the tag is: (5'-CATCATCATCATCATCATCATCATCATCAT-3 '; HHHHHHHHHH); the entire sequence was synthesized as a template for gene cloning.
[0026] 2. Take the above-mentioned synthesized target fragment containing B-tag and 10×his tag as the template of PCR reaction, and design the upstream primer that introduces the NcoI restriction site, as shown in SEQ ID NO: 4; the primer sequence is: (5' -ATGCTCCATGGATCCAGCGTACTCCAAAAGATT-3'); the downstream primer for introducing the XhoI restriction site is shown in SEQ ID NO: 5; the auxiliary expres...
Embodiment 2
[0035] 1. Optimize the codon of the ADCY2 gene. The optimized codon and nucleotide sequence are shown in SEQ ID NO: 1, and a 10×his tag is added to the C-terminus of the ADCY2 gene in the codon-optimized sequence, as shown in SEQ ID NO: shown as 3; the label is: (CATCATCATCATCATCATCATCATCATCAT; HHHHHHHHHH); the entire sequence was synthesized and used as a template for gene cloning.
[0036] 2. Take the target fragment containing the 10×his tag synthesized above as a template for the PCR reaction, and design an upstream primer that introduces the NcoI restriction site, as shown in SEQ ID NO: 4; the primer sequence is:
[0037](5'-ATGCTCCATGGATCCAGCGTACTCCAAAAGATT-3'); the downstream primer introduced into the XhoI restriction site is shown in SEQ ID NO: 5; the auxiliary expression sequence is:
[0038] (5-GGGCCCTCGAGATGATGATGATGATGATGATGATGATGATG-3'); 4.0 μL template, 2 μL 10 μmol / L upstream and downstream primers, 1.0 μL Pfu DNA polymerase (5U / μL), 10 μL 10× Buffer, and 5.0 μ...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com