Unlock instant, AI-driven research and patent intelligence for your innovation.

Improved preparation method of adenylate cyclase

A technology of adenylyl cyclase and nucleotide sequence, applied in biochemical equipment and methods, botany equipment and methods, enzymes, etc.

Inactive Publication Date: 2017-08-18
WUHAN GENECREATE BIOLOGICAL ENG CO LTD
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0002] Structural and functional analysis requires a large number of membrane protein samples, but a bottleneck is how to obtain membrane proteins in large quantities and efficiently

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Improved preparation method of adenylate cyclase
  • Improved preparation method of adenylate cyclase
  • Improved preparation method of adenylate cyclase

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] 1. Optimize the codon of the ADCY2 gene. The optimized codon and nucleotide sequence are shown in SEQ ID NO: 1, and the expression-assisted sequence B-tag is added to the N segment of the ADCY2 gene after codon optimization, such as Shown in SEQ ID NO: 2; the helper expression sequence is: (5'-ATCCAGCGTACTCCAAAGATTCAGGTTTACTCACGTCATCCAGCAGAGAATGGAAAGTCAATTTCCTGAATTGCTAT-3'); 10×his tag is added to the C-terminus, as shown in SEQ ID NO: 3; the tag is: (5'-CATCATCATCATCATCATCATCATCATCAT-3 '; HHHHHHHHHH); the entire sequence was synthesized as a template for gene cloning.

[0026] 2. Take the above-mentioned synthesized target fragment containing B-tag and 10×his tag as the template of PCR reaction, and design the upstream primer that introduces the NcoI restriction site, as shown in SEQ ID NO: 4; the primer sequence is: (5' -ATGCTCCATGGATCCAGCGTACTCCAAAAGATT-3'); the downstream primer for introducing the XhoI restriction site is shown in SEQ ID NO: 5; the auxiliary expres...

Embodiment 2

[0035] 1. Optimize the codon of the ADCY2 gene. The optimized codon and nucleotide sequence are shown in SEQ ID NO: 1, and a 10×his tag is added to the C-terminus of the ADCY2 gene in the codon-optimized sequence, as shown in SEQ ID NO: shown as 3; the label is: (CATCATCATCATCATCATCATCATCATCAT; HHHHHHHHHH); the entire sequence was synthesized and used as a template for gene cloning.

[0036] 2. Take the target fragment containing the 10×his tag synthesized above as a template for the PCR reaction, and design an upstream primer that introduces the NcoI restriction site, as shown in SEQ ID NO: 4; the primer sequence is:

[0037](5'-ATGCTCCATGGATCCAGCGTACTCCAAAAGATT-3'); the downstream primer introduced into the XhoI restriction site is shown in SEQ ID NO: 5; the auxiliary expression sequence is:

[0038] (5-GGGCCCTCGAGATGATGATGATGATGATGATGATGATGATG-3'); 4.0 μL template, 2 μL 10 μmol / L upstream and downstream primers, 1.0 μL Pfu DNA polymerase (5U / μL), 10 μL 10× Buffer, and 5.0 μ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an improved preparation method of adenylate cyclase. The preparation method comprises the following steps: (1) optimizing a codon of a to-be-expressed gene; (2) carrying out PCR reaction on a target fragment; (3) purifying and recycling a PCR product; (4) constructing a recombinant expression carrier; and (5) carrying out cell-free protein synthesis reaction on a target gene. The preparation method disclosed by the invention has the advantages that molecular biology and genetic engineering methods are adopted, the recombinant expression carrier of an adenylate cyclase gene is constructed, and expression is induced, so that a recombinant protein is obtained.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to an improved preparation method of adenylyl cyclase. Background technique [0002] Structural and functional analysis requires a large number of membrane protein samples, but a bottleneck is how to obtain membrane proteins in large quantities and efficiently. The reduced complexity of producing proteins in a cell-free expression system leads to efficient operation of the transcription-translation process. The strategy of using helper sequences can lead to rapid improvement of cell-free expression efficiency based on the optimization of translation initiation. High-frequency use of rare codons and unfavorable initiation of translation have been identified as major limiting steps in protein biosynthesis, and formation of secondary structures involving high-risk secondary structures in 5' regions of mRNA such as ribosome binding sites can be slowed down or ev...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/88C12N15/60C12N15/70
CPCC12N9/88C12N15/70C12N2800/101C12N2800/22C12Y406/01001
Inventor 华权高沈鹤霄马峰罗绍祥肖颖舒芹徐春雷王静邓陈玲易汪雪李昆鹏
Owner WUHAN GENECREATE BIOLOGICAL ENG CO LTD