A kind of sgRNA sequence and its application of specific knockout dihydrofolate reductase gene
A technology of dihydrofolate and reductase, which is applied in the field of genetic engineering, can solve the problems of high cytotoxicity and achieve the effect of increasing production
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0046] Example 1 Using the sgRNA sequence of the present invention to knock out the dihydrofolate reductase gene of CHO cells
[0047] 1. Design sgRNA targeting the DHFR gene of CHO-S cells
[0048] According to the DHFR gene sequence of CHO cells published by Genbank, different sgRNA sequences are designed for the first exon (Exon1). The designed sgRNA sequences are shown in Table 1:
[0049] Table 1 Sequence of sgRNAs
[0050] Serial number
SgRNA sequence (5‐‐3)
direction
PAM sequence
SgRNA sequence position
SgRNA1‐h (SEQ ID NO: 1)
GCAAGAACGGAGACCUUCCC
Positive
TGG
Exon1
SgRNA2-h (SEQ ID NO: 2)
GUCGCCGUGUCCCAGAAUAU
Positive
GGG
Exon1
SgRNA3-h (SEQ ID NO: 3)
GCCAAUGCUCAGGUACUGGC
Positive
TGG
Exon1
[0051] The DHFR gene Exon1 partial sequence and sgRNA targeting sequence of CHO-S cells can be seen figure 1 .
[0052] Extract CHO-S cell genomic DNA, use the primers in Table 2 to amplify genomic DNA, gel to recover the amplified product, and connect to the precu...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



