A kind of fructo-oligosaccharide synthesis engineering strain expressing glucose oxidase and its construction method and application

A technology of glucose oxidase and fructo-oligosaccharides, applied in the field of genetic engineering, can solve the problems of high production cost of high-purity fructo-oligosaccharides, unsuitability for large-scale industrial production, cumbersome and complicated operation and control, etc., and achieve strong application value , reduce the inhibitory effect, and promote the effect of positive conversion

Active Publication Date: 2020-11-20
SHANDONG UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, the preparation methods of high-purity fructo-oligosaccharides can be divided into two types: one is a two-step method, that is, firstly, β-fructofuranosidase is used to convert sucrose into about 55% fructo-oligosaccharides, and then the glucose is filtered out by chromatography, etc. and sucrose to obtain high-purity fructo-oligosaccharide products, but this method has the disadvantages of high cost of separation equipment, cumbersome and complicated operation and control, and high maintenance costs, making the production cost of high-purity fructo-oligosaccharides high; the other is the mixed enzyme method , that is, glucose oxidase is added to the system of β-fructofuranosidase reaction to synthesize fructo-oligosaccharides, and the by-product glucose is oxidized to gluconic acid to relieve the inhibitory effect and promote the further synthesis of fructo-oligosaccharides, thereby obtaining high-purity fructo-oligosaccharides Polyfructose, but this method requires the preparation of glucose oxidase in vitro, which not only increases the cost, but also easily causes product pollution, and is not suitable for large-scale industrial production
[0004] So far, there is no report on the expression of glucose oxidase in fructooligosaccharide-synthesizing strains at home and abroad, and there is no use of glucose oxidase and β-fructofuranosidase (FopA) C-terminal domain for fusion expression to construct engineering bacteria and apply A report on the preparation of fructooligosaccharides

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of fructo-oligosaccharide synthesis engineering strain expressing glucose oxidase and its construction method and application
  • A kind of fructo-oligosaccharide synthesis engineering strain expressing glucose oxidase and its construction method and application
  • A kind of fructo-oligosaccharide synthesis engineering strain expressing glucose oxidase and its construction method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1. The fusion of the C-terminal domain gene fopA-C of the glucose oxidase gene gox and the β-fructofuranosidase FopA to obtain the fusion gene gox-fopA-C

[0031]First, use Aspergillus niger ATCC1015 chromosomal DNA as a template, gox-1F / gox-1815R as primers to amplify a 1.8kb gox gene fragment with a fopA-C linker without a stop codon, and use Aspergillus niger ATCC 20611 chromosomal DNA as a template , fopA-438F / fopA-965R are primers to amplify the fopA-C gene fragment of 0.3kb, and then use Double jointPCR technology to fuse gox and fopA-C two genes to obtain a gox-fopA-C fusion gene with a size of 2.1kb ( figure 1 ).

[0032] The above primer pairs are as follows:

[0033] gox-1F: ATGCAGACTCTCCTTGTGAG

[0034] gox-1815R: CTGAACTGGTAGTAGATGGCCTGCATGGAAGCATAATC

[0035] fopA-438F: GCCATCTACTACCAGTTC

[0036] fopA-965R: TCACCACGATCTCGCCCAGGT

Embodiment 2

[0037] Example 2. Construction of glucose oxidase GOX fusion FopA C-terminal domain expression vector pGOC

[0038] The expression vector pGOC was constructed with the pMD 19-T vector as the backbone, including the C-terminal domain fusion gene gox-fopA-C of the promoter PgpdA, glucose oxidase and FopA, and the terminator TtrpC ( figure 2 A); First, using the plasmid pAN7-1 (Punt et al., Gene.1987, 56, 117-24.) as a template, the primer pair PgpdA-1192UF / PgpdA-7UR and TtrpC-1044DF / TtrpC-1805DR were used to amplify gox The 1.2kb PgpdA of the joint and the TtrpC with the fopA-C joint of 0.7kb, then the fusion gene gox-fopA-C is connected with the promoter PgpdA and the terminator TtrpC to form the fusion gene gox-fopA-C expression cassette; The fusion fragment of the expression cassette was cloned into the pMD 19-T vector, and the single clone was picked for verification. The verified plasmid was named pGOC. See the plasmid map figure 2 As shown in A.

[0039] The above prim...

Embodiment 3

[0044] Example 3. Using expression vector pGOC to transform Aspergillus niger ATCC 20611 to construct fructooligosaccharide synthesis engineering bacteria expressing glucose oxidase

[0045] The genetic transformation of Aspergillus niger ATCC 20611 was performed using PEG / CaCl 2 Mediated protoplast transformation method, pyrithione resistance gene ptrA as selection marker. 10 μg of the purified plasmid pGOC and plasmid pME2892 (Krappmann et al., Eukaryotic Cell. 2005, 4, 1298–1307.) containing the ptrA expression cassette were mixed and co-transformed into Aspergillus niger ATCC 20611.

[0046] The above PEG / CaCl 2 The specific method of mediated protoplast transformation is as follows:

[0047] (1) Preparation of Aspergillus niger ATCC 20611 protoplasts:

[0048] Aspergillus niger ATCC 20611 spores were inoculated into 50ml MM liquid medium (the final concentration of spores was 1×10 6 Individual / ml), 30 ℃, 200rpm culture 30h; The thalline is collected by centrifugation ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a glucose oxidase-expressing fructooligosaccharide-synthesizing engineered strain. The genome of the engineered strain contains the fusion gene gox-fopA-C; the starting strain of the engineered strain is Aspergillus niger ATCC 20611; the fusion gene gox-fopA-C is prepared through fusion of the gox gene coding glucose oxidase GOX and the fopA-C gene coding the FopA-C terminal domain of beta-fructofuranosidase; and the fusion gene has a nucleotide sequence as shown in SEQ ID No. 1, the upstream of the nucleotide sequence is a glyceraldehyde-3-phosphate dehydrogenase promoter PgpdA of Aspergillus nidulans, and the downstream of the nucleotide sequence is a tryptophan terminator TtrpC of Aspergillus nidulans. The invention also discloses application of the engineered strain to preparation of fructooligosaccharide. Experimental results show that the activity of glucose oxidase in the engineered strain reaches 90.0 U / g, the activity of beta-fructofuranosidase reaches 380 U / g, mycelia are directly used for preparation of fructooligosaccharide, and the content of prepared fructooligosaccharide reaches 71.2%. The method has the advantages of simple and convenient operation, capacity of realizing one-step enzymatic preparation of high-purity fructooligosaccharide and good industrial application value.

Description

technical field [0001] The invention relates to a fructo-oligosaccharide synthesis engineering strain expressing glucose oxidase, a construction method thereof and an application in preparing fructo-oligosaccharide, belonging to the technical field of genetic engineering. Background technique [0002] Fructooligosaccharides (FOS for short), also known as functional fructooligosaccharides, is a sucrose triose (GF) formed by combining several D-fructose with β-1,2 glycosidic bonds on the sucrose molecule. 2 ), Kestose (GF 3 ) and fructopentose (GF 4 ) and their mixtures. Fructose-oligosaccharides have physiological effects such as regulating the balance of intestinal flora, reducing blood lipids, and promoting calcium and magnesium absorption, and are widely used in the fields of food, beverages, and medicine. In industry, microbial enzymatic methods are usually used to produce large amounts of fructo-oligosaccharides. High-concentration sucrose is used as raw material, and...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N1/15C12N15/62C12P19/14C12R1/685
CPCC07K2319/00C12N9/0006C12N9/2431C12P19/14C12Y101/03004C12Y302/01026
Inventor钟耀华张静刘彩霞谢益佳隆倩
OwnerSHANDONG UNIV