Primer pair and method for identifying low-nornicotine mutant filial generation genotype of tobacco

A technology of primer pair and nornicotine, which is applied in the field of agricultural biology, can solve problems such as reducing the content of TSNAs in tobacco leaves and complicated detection of nornicotine, so as to speed up the breeding process and improve the selection efficiency

Active Publication Date: 2018-01-09
GUIZHOU TOBACCO SCI RES INST +1
View PDF3 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Because the detection of nornicotine is easily affected by the environment and the detection is relatively complicated, it is difficult to breed varieties with low nornicotine content by conventional breeding methods. RNAi, gene knockout, EMS mutagenesis and other technologies are used to block or reduce the tendency of nicotine in tobacco. The conversion of nornicotine is an important way to improve the quality of tobacco leaves and reduce the content of TSNAs in tobacco leaves

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer pair and method for identifying low-nornicotine mutant filial generation genotype of tobacco
  • Primer pair and method for identifying low-nornicotine mutant filial generation genotype of tobacco

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0021] A primer and method for identifying the genotype of hybrid offspring of tobacco reduced nornicotine mutants: comprising the following steps:

[0022] (1) extracting the total DNA of the tobacco sample seedling stage leaves;

[0023] (2) Using the total DNA as a template, use the primer pair Seq ID No.1: 5' GATGAGATGTGTGCATACTTG3'; Seq ID No.2: 5' CCAAATTAGAAAAACTCGTACTG 3' to perform PCR amplification;

[0024] (3) PCR products are scanned by HRM detection instrument LightScanner96;

[0025] (4) According to the HRM curve results, determine the genotype of the tobacco sample; when the HRM curve is consistent with wild-type Guiyan No. 1 ( figure 1 , gray curve), it is the wild (non-mutant) type; if the peak value of the HRM fluorescence curve ΔF≥0.05, and the curve is consistent with the homozygous mutant, it is the homozygous mutant ( figure 1 ); if other curve types appear, it is a heterozygous mutation type ( figure 1 ).

[0026] Specific implementation:

[0027]...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a primer pair for identifying the low-nornicotine mutant filial generation genotype of tobacco. The primer pair is characterized in that the primer 1 is a sequence as shown inSeq ID No.1, namely 5'GATGAGATGTGTGCATACTTG3', and the primer 2 is a sequence, namely 5'CCAAATTAGAAAAACTCGTACTG3', as shown in Seq ID No.2. The primer pair combined with HRM can be used for screeninga great quantity of filial generation populations, and effectively differentiating non-mutant, mutant hybrid and mutant homozygote, so that materials containing tobacco CYP82E4 mutant genes can be accurately and efficiently identified.

Description

technical field [0001] The invention relates to a primer and a method for identifying the genotype of hybrid progeny of tobacco reduced nornicotine mutants, belonging to the field of agricultural biotechnology. Background technique [0002] The content of nornicotine in tobacco directly affects the quality and safety of tobacco products. Nornicotine can form tobacco-specific nitrosamines (TSNAs) through nitrosation, and TSNAs can induce various cancers in experimental animals. Among them, NNN and NNK Carcinogenicity has been verified. [0003] Tobacco is an economic crop rich in alkaloids, of which nicotine is the most important alkaloid. During the process of growth, aging, and conditioning of tobacco, nicotine will be demethylated and converted into nornicotine. Because the detection of nornicotine is easily affected by the environment and the detection is relatively complicated, it is difficult to breed varieties with low nornicotine content by conventional breeding meth...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
Inventor 张吉顺任学良赵海军张超王仁刚张孝廉
Owner GUIZHOU TOBACCO SCI RES INST
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap