Amplification primer of cytochrome b gene of lanius tigrinus and lanius schach and amplification method

Abstract

The invention discloses an amplification primer of a cytochrome b gene of lanius tigrinus and lanius schach and an amplification method and belongs to the technical field of biology. The amplificationprimer comprises a specific primer of HWBLP-F14 shown as SEQ ID No. (sequence identifier number) 1 (CCTACTCCATCAAATATCTC) and containing 20 basic groups, and a specific primer of HWBLP-R14 shown as SEQ ID No. 2 (TTTGGTTTACAAGACCAATG). DNA (deoxyribonucleic acid) is extracted by a phenol-chloroform extraction method; at last, an optimized PCR (polymerase chain reaction) system is used for amplification; the species specific amplification primer is adopted and has good species specificity; introduction of an A basic group is avoided at 3' terminals of all primers, so that the probability of non-specific amplification is greatly reduced; the workload of massive primer design and literature review is avoided; since an optimized PCR amplification procedure is adopted, the amplification activity of DNA polymerase is fully exerted; the cytochrome b gene of the lanius tigrinus and the lanius schach are amplified efficiently and stably; a PCR amplification product can be directly used for sequencing; and the workload of an operator is greatly reduced.

Description

Technical field [0001] The invention belongs to the field of biotechnology, and relates to the technical field of gene amplification primers and amplification methods, in particular to an amplification primer and an amplification method for cytochrome b genes of tiger shrike and brown-backed shrike. Background technique [0002] The tiger shrike and brown-backed shrike belong to the genus Passerine Shrike Shrike in taxonomy. Passerine birds are the largest group of birds in the class of birds. They mainly feed on pests. The origin and evolution of this group have always been the focus of attention in ornithology. Molecular systematics has great advantages in solving the origin and evolution of various biological groups, and many controversial issues can be solved by molecular means. However, molecular biology research related to passerine birds is still weak, which has affected the solution of the systematic problems of this group. Compared with nuclear genome, bird mitochondri...

AI Technical Summary

Problems solved by technology

As disclosed in Chinese Patent Publication No. CN105861665A, PCR technology is used to amplify the avian influenza virus gene, and the amplified gene is tested. This method has the advantages of small time consumption, simplicity and cost saving, but successful PCR amplification Accurate control of many factors is required. The amplification is not only affected by the DNA template of the amplified target sequence, but also related to the amplification system and conditions, including changes in dNTP concentration, primer concentration, and template amount, etc., which all affect the amplification results.

In the current research process, due to lack of understanding of species background knowledge, a large number of new primers are designed and synthesized, resulting in high amplification costs, poor amplification effects, and labor-intensive

Images