Unlock instant, AI-driven research and patent intelligence for your innovation.

Tbc1d14 gene over-expression adenovirus vector as well as building and packaging methods of vector

A technology of tbc1d14 and 1.tbc1d14 is applied in the construction of the above-mentioned adenovirus vector, adenovirus and packaging, which can solve the problems of low success rate and high cytotoxicity, and achieve the effect of high titer.

Inactive Publication Date: 2018-06-01
SOUTHWEST UNIV
View PDF5 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The purpose of the present invention is to provide tbc1d14 gene overexpression adenoviral vector, which solves the problems of high cytotoxicity and low success rate of existing mouse tbc1d14 gene overexpression

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Tbc1d14 gene over-expression adenovirus vector as well as building and packaging methods of vector
  • Tbc1d14 gene over-expression adenovirus vector as well as building and packaging methods of vector
  • Tbc1d14 gene over-expression adenovirus vector as well as building and packaging methods of vector

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0043] The present invention will be described in detail below in conjunction with the accompanying drawings and specific embodiments.

[0044] The nucleotide sequence of the mouse tbc1d14 gene in the present invention is shown in SEQ.ID.NO.1.

[0045] The nucleotide sequence of the mouse tbc1d14 gene targeted by the present invention is as follows:

[0046] ATGAGGCTTTATCTAGACCGCTTCTGGGGACTGATGGCAAAAGTTTCTTCTGGGACCAAGATGACTGATGGAAACCTTTCCACCTCGATGAATGGTGTAGCATTGATGGGCATCCTAGATGGTCGGCAAGGAGACTCCCTTCAGGACCTACAACACCTTAGTATCAAGGCGGCTCCCAGATCCCTTTCAGTGCCTGACTACGGACCTTCACTAAAACTTGGTGCTTTGGAAGATCGACACAGCCTTCAATCAGTGGACTCGGGCATTCCTACCCTGGAGATTGGCAACCCAGAGCCTGTTCCCTGCAGTGTGGTCCATGTGAAGAGAAAGCAGTCTGAGTCAGAGATCGTCCCGGAGCGGGCCTTCCAGAGTGCATGCCCGCTGCCGTCGTGCACACCCTCAGCTCCCACCTGCAGCGAGCGGGAGCAGGTTGTGCGGAAGTCTTCCACATTTCCTAGGACAGGCTATGACTCAGTGAAACTCTACAGCCCCACCTCCAAAGCCTTGAGCCGAAGTGACAATGTCTCTGTCTGCAGTGTGTCTAGTCTTGGCACAGAGCTGTCAACTACGTTGTCGGTCAGCAATGAGGACATCTTGGACCTCATGGTCACGAGCAATTCCAGCGCTATTG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
diameteraaaaaaaaaa
Login to View More

Abstract

The invention discloses a tbc1d14 gene over-expression adenovirus vector. pHBA(+)-EF1-MCS-GFP is taken as a vector, and a tbc1d14 gene is connected integrally for recombining to obtain the tbc1d14 gene over-expression adenovirus vector. The invention further discloses a building method of the adenovirus vector, a packaging method of an adenovirus and an obtained adenovirus. An adenovirus expression system is adopted, an exogenous gene mouse tbc1d14 gene is built onto an adenovirus framework vector by a homologous recombination method, and a recombined adenovirus A(+)-tbc1d14 is built to obtaina high-titer recombinant adenovirus. The tbc1d14 gene over-expression adenovirus vector is the most efficient, reliable and stable mouse tbc1d14 gene expression system at present, and can be used forexpressing a mouse tbc1d14 objective protein in mammalian cells instantaneously at a high level, so that a basis is laid for the research of the biological function of the tbc1d14 gene in a cell autophagy process.

Description

technical field [0001] The invention belongs to the technical field of cell biology, and specifically relates to an adenovirus vector for overexpressing tbc1d14 gene. The invention also relates to a construction method of the adenovirus vector, and an adenovirus obtained by packaging the adenovirus vector and a packaging method. Background technique [0002] The formation of autophagosomes is a complex process. This process requires the rearrangement of the cell membrane structure, the formation of double-membrane vesicles and the degradation of lysosomes. To investigate the molecular mechanism of transport of these membrane structures, it has been reported that by disrupting the membrane structure of superfamily proteins containing TBC (Tre2 / Bub2 / Cdc16) domains, a direct relationship between TBC and autophagosome formation can be inferred. TBC protein, as an inhibitor of Rab protein, has the function of regulating membrane transport, and tbc1d14, as an essential protein in...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/861C12N7/01C12R1/93
CPCC12N7/00C12N15/86C12N2710/10321C12N2710/10343C12N2710/10352C12N2800/107
Inventor 焦寒伟黄庆洲帅学宏郭芳芳陈吉轩伍莉甘玲罗献梅王红均
Owner SOUTHWEST UNIV