Tbc1d14 gene over-expression adenovirus vector as well as building and packaging methods of vector

A technology of tbc1d14 and 1.tbc1d14 is applied in the construction of the above-mentioned adenovirus vector, adenovirus and packaging, which can solve the problems of low success rate and high cytotoxicity, and achieve the effect of high titer.

CN108103101AInactive Publication Date: 2018-06-01SOUTHWEST UNIV
5 Cites 1 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Publication Date
2018-06-01
Estimated Expiration
Not applicable · inactive patent

Smart Images

  • Figure 1
    Figure 1
  • Figure 2
    Figure 2
  • Figure 3
    Figure 3
Patent Text Reader

Abstract

The invention discloses a tbc1d14 gene over-expression adenovirus vector. pHBA(+)-EF1-MCS-GFP is taken as a vector, and a tbc1d14 gene is connected integrally for recombining to obtain the tbc1d14 gene over-expression adenovirus vector. The invention further discloses a building method of the adenovirus vector, a packaging method of an adenovirus and an obtained adenovirus. An adenovirus expression system is adopted, an exogenous gene mouse tbc1d14 gene is built onto an adenovirus framework vector by a homologous recombination method, and a recombined adenovirus A(+)-tbc1d14 is built to obtaina high-titer recombinant adenovirus. The tbc1d14 gene over-expression adenovirus vector is the most efficient, reliable and stable mouse tbc1d14 gene expression system at present, and can be used forexpressing a mouse tbc1d14 objective protein in mammalian cells instantaneously at a high level, so that a basis is laid for the research of the biological function of the tbc1d14 gene in a cell autophagy process.
Need to check novelty before this filing date? Find Prior Art

Description

technical field

[0001] The invention belongs to the technical field of cell biology, and specifically relates to an adenovirus vector for overexpressing tbc1d14 gene. The invention also relates to a construction method of the adenovirus vector, and an adenovirus obtained by packaging the adenovirus vector and a packaging method. Background technique

[0002] The formation of autophagosomes is a complex process. This process requires the rearrangement of the cell membrane structure, the formation of double-membrane vesicles and the degradation of lysosomes. To investigate the molecular mechanism of transport of these membrane structures, it has been reported that by disrupting the membrane structure of superfamily proteins containing TBC (Tre2 / Bub2 / Cdc16) domains, a direct relationship between TBC and autophagosome formation can be inferred. TBC protein, as an inhibitor of Rab protein, has the function of regulating membrane transport, and tbc1d14, as an essential protein in...

Examples

Embodiment Construction

[0043] The present invention will be described in detail below in conjunction with the accompanying drawings and specific embodiments.

[0044] The nucleotide sequence of the mouse tbc1d14 gene in the present invention is shown in SEQ.ID.NO.1.

[0045] The nucleotide sequence of the mouse tbc1d14 gene targeted by the present invention is as follows:

[0046] ATGAGGCTTTATCTAGACCGCTTCTGGGGACTGATGGCAAAAGTTTCTTCTGGGACCAAGATGACTGATGGAAACCTTTCCACCTCGATGAATGGTGTAGCATTGATGGGCATCCTAGATGGTCGGCAAGGAGACTCCCTTCAGGACCTACAACACCTTAGTATCAAGGCGGCTCCCAGATCCCTTTCAGTGCCTGACTACGGACCTTCACTAAAACTTGGTGCTTTGGAAGATCGACACAGCCTTCAATCAGTGGACTCGGGCATTCCTACCCTGGAGATTGGCAACCCAGAGCCTGTTCCCTGCAGTGTGGTCCATGTGAAGAGAAAGCAGTCTGAGTCAGAGATCGTCCCGGAGCGGGCCTTCCAGAGTGCATGCCCGCTGCCGTCGTGCACACCCTCAGCTCCCACCTGCAGCGAGCGGGAGCAGGTTGTGCGGAAGTCTTCCACATTTCCTAGGACAGGCTATGACTCAGTGAAACTCTACAGCCCCACCTCCAAAGCCTTGAGCCGAAGTGACAATGTCTCTGTCTGCAGTGTGTCTAGTCTTGGCACAGAGCTGTCAACTACGTTGTCGGTCAGCAATGAGGACATCTTGGACCTCATGGTCACGAGCAATTCCAGCGCTATTG...