Tbc1d14 gene over-expression adenovirus vector as well as building and packaging methods of vector
A technology of tbc1d14 and 1.tbc1d14 is applied in the construction of the above-mentioned adenovirus vector, adenovirus and packaging, which can solve the problems of low success rate and high cytotoxicity, and achieve the effect of high titer.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0043] The present invention will be described in detail below in conjunction with the accompanying drawings and specific embodiments.
[0044] The nucleotide sequence of the mouse tbc1d14 gene in the present invention is shown in SEQ.ID.NO.1.
[0045] The nucleotide sequence of the mouse tbc1d14 gene targeted by the present invention is as follows:
[0046] ATGAGGCTTTATCTAGACCGCTTCTGGGGACTGATGGCAAAAGTTTCTTCTGGGACCAAGATGACTGATGGAAACCTTTCCACCTCGATGAATGGTGTAGCATTGATGGGCATCCTAGATGGTCGGCAAGGAGACTCCCTTCAGGACCTACAACACCTTAGTATCAAGGCGGCTCCCAGATCCCTTTCAGTGCCTGACTACGGACCTTCACTAAAACTTGGTGCTTTGGAAGATCGACACAGCCTTCAATCAGTGGACTCGGGCATTCCTACCCTGGAGATTGGCAACCCAGAGCCTGTTCCCTGCAGTGTGGTCCATGTGAAGAGAAAGCAGTCTGAGTCAGAGATCGTCCCGGAGCGGGCCTTCCAGAGTGCATGCCCGCTGCCGTCGTGCACACCCTCAGCTCCCACCTGCAGCGAGCGGGAGCAGGTTGTGCGGAAGTCTTCCACATTTCCTAGGACAGGCTATGACTCAGTGAAACTCTACAGCCCCACCTCCAAAGCCTTGAGCCGAAGTGACAATGTCTCTGTCTGCAGTGTGTCTAGTCTTGGCACAGAGCTGTCAACTACGTTGTCGGTCAGCAATGAGGACATCTTGGACCTCATGGTCACGAGCAATTCCAGCGCTATTG...
PUM
| Property | Measurement | Unit |
|---|---|---|
| diameter | aaaaa | aaaaa |
| diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 


