Tbc1d14 gene over-expression adenovirus vector as well as building and packaging methods of vector
A technology of tbc1d14 and 1.tbc1d14 is applied in the construction of the above-mentioned adenovirus vector, adenovirus and packaging, which can solve the problems of low success rate and high cytotoxicity, and achieve the effect of high titer.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0043] The present invention will be described in detail below in conjunction with the accompanying drawings and specific embodiments.
[0044] The nucleotide sequence of the mouse tbc1d14 gene in the present invention is shown in SEQ.ID.NO.1.
[0045] The nucleotide sequence of the mouse tbc1d14 gene targeted by the present invention is as follows:
[0046] ATGAGGCTTTATCTAGACCGCTTCTGGGGACTGATGGCAAAAGTTTCTTCTGGGACCAAGATGACTGATGGAAACCTTTCCACCTCGATGAATGGTGTAGCATTGATGGGCATCCTAGATGGTCGGCAAGGAGACTCCCTTCAGGACCTACAACACCTTAGTATCAAGGCGGCTCCCAGATCCCTTTCAGTGCCTGACTACGGACCTTCACTAAAACTTGGTGCTTTGGAAGATCGACACAGCCTTCAATCAGTGGACTCGGGCATTCCTACCCTGGAGATTGGCAACCCAGAGCCTGTTCCCTGCAGTGTGGTCCATGTGAAGAGAAAGCAGTCTGAGTCAGAGATCGTCCCGGAGCGGGCCTTCCAGAGTGCATGCCCGCTGCCGTCGTGCACACCCTCAGCTCCCACCTGCAGCGAGCGGGAGCAGGTTGTGCGGAAGTCTTCCACATTTCCTAGGACAGGCTATGACTCAGTGAAACTCTACAGCCCCACCTCCAAAGCCTTGAGCCGAAGTGACAATGTCTCTGTCTGCAGTGTGTCTAGTCTTGGCACAGAGCTGTCAACTACGTTGTCGGTCAGCAATGAGGACATCTTGGACCTCATGGTCACGAGCAATTCCAGCGCTATTG...
PUM
Property | Measurement | Unit |
---|---|---|
diameter | aaaaa | aaaaa |
diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap