Supercharge Your Innovation With Domain-Expert AI Agents!

Pig endogenous retrovirus vector and construction method thereof

A technology of retrovirus and construction method, which is applied in the field of porcine endogenous retrovirus vector and its construction, can solve problems such as retrovirus vectors that have not yet been seen, and achieve the elimination of doubts about safety and genetic background Clear, broad host range effects

Inactive Publication Date: 2010-12-01
FIELD OPERATION BLOOD TRANSFUSION INST OF PLA SCI ACAD OF MILITARY +1
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0010] At present, international research on PERV focuses on the evaluation of its pathogenic safety in xenotransplantation, and so far there has been no report on the use of PERV as a retroviral vector

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Pig endogenous retrovirus vector and construction method thereof
  • Pig endogenous retrovirus vector and construction method thereof
  • Pig endogenous retrovirus vector and construction method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] Embodiment 1, the construction of porcine endogenous retrovirus vector PM-1

[0047] Use method of the present invention to construct porcine endogenous retrovirus vector PM-1 (such as Figure 3A-Figure 3C shown), the specific method is as follows:

[0048] According to the complete gene sequence of Wuzhishan minipig PERV (WZS-PERV) (GenBank number: EF133960, the structure is as follows figure 1 shown) and MSCVneo sequence (see www.clontech.com for the sequence, Protocol # PT3301-5, see the map figure 2 ) designed 5 pairs of primers. The P-5'LTR and P-3'LTR fragments were amplified from WZS-PERV genomic DNA by PCR method, and the ψ, neo and O-Amp fragments were amplified from MSCVneo vector by PCR method. The primer sequences are as follows:

[0049] P1: 5'LTR-F CGG TGAAAGGATGAAAATGCAACCT (sequence 1 in the sequence listing)

[0050] P2: 5'LTR-R ATCTCGGTGGAACCTCCATGAAAGGCCAGTCGA (sequence 2 in the sequence listing)

[0051] P3: ψ-F CTCGACTGGCCTTTCATGGAGGTTCCACC...

Embodiment 2

[0063] Embodiment 2, construction of expression plasmid PM-1-GFP-21

[0064] According to the sequence of the GFP gene coding region, Xho I and Bgl II restriction sites were respectively introduced to synthesize primers. The primer sequences and the conditions of polymerase chain reaction (PCR) were as follows:

[0065] P15: GFPXho I CCG CCATGGTGAGCAAGGGCGA

[0066] P16: GFPBgl II GGA TTACTTGTACAGCTCGTCCAT

[0067] The 50 μl reaction system includes: 0.5 μl cDNA (100 ng / μl), 1 μl each of primers R and F (20 μM), 4 μl dNTP (2.5 mM), 0.5 μl Super-L taq DNA polymerase (NEB Company), 5 μl 10×PCRBuffer, 38 μl sterile water. The reaction conditions are: denaturation at 94°C for 3 minutes; 30 cycles at 94°C for 30s, 54°C for 45s, 72°C for 1min30s, and 72°C for 7min. The GFP gene fragment amplified by PCR was detected by 1% agarose gel electrophoresis, and the results were as follows: Figure 8 As shown (a. DL2000 Marker, b. GFP gene 740bp), consistent with the expected result...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a pig endogenous retrovirus vector and a construction method and application thereof. The vector constructed in the invention has the following advantages of: efficiently infecting various cells and having wide host range, efficiently integrating a target gene into a genome of the infected cells and expressing in a high level, having efficient infection characteristic, transmitting a recombinant target gene to an entire cell colony, combining with a tissue specificity promoter and probably fulfilling the aims of positioning and expressing the target gene in specific tissues or organs, along with higher suitability for gene therapy and other application.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to a retrovirus vector and a construction method thereof, in particular to a pig endogenous retrovirus vector and a construction method thereof. Background technique [0002] Retroviral vectors are gene transfer vectors commonly used in clinical gene therapy trials. Compared with other non-viral vectors and viral vectors, retroviral vectors have many unique advantages, including high-efficiency transduction of various types of cells, and ability to integrate into hosts. The exogenous gene carried by it is stably expressed in the chromosome of the cell for a long time. Most of the structural protein coding sequences gag, pol, and env genes are removed from the retroviral vectors currently used by people, so that the virus loses the ability to replicate and form virions. [0003] These three viral structural proteins need to be included in the vector packaging system by constructing co-tra...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/867C12N5/10C12N1/15C12N1/19C12N1/21
Inventor 章金刚吕茂民吴健敏冯书堂徐述丁芳马玉媛
Owner FIELD OPERATION BLOOD TRANSFUSION INST OF PLA SCI ACAD OF MILITARY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More