Pig endogenous retrovirus vector and construction method thereof
A technology of retrovirus and construction method, which is applied in the field of porcine endogenous retrovirus vector and its construction, can solve problems such as retrovirus vectors that have not yet been seen, and achieve the elimination of doubts about safety and genetic background Clear, broad host range effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0046] Embodiment 1, the construction of porcine endogenous retrovirus vector PM-1
[0047] Use method of the present invention to construct porcine endogenous retrovirus vector PM-1 (such as Figure 3A-Figure 3C shown), the specific method is as follows:
[0048] According to the complete gene sequence of Wuzhishan minipig PERV (WZS-PERV) (GenBank number: EF133960, the structure is as follows figure 1 shown) and MSCVneo sequence (see www.clontech.com for the sequence, Protocol # PT3301-5, see the map figure 2 ) designed 5 pairs of primers. The P-5'LTR and P-3'LTR fragments were amplified from WZS-PERV genomic DNA by PCR method, and the ψ, neo and O-Amp fragments were amplified from MSCVneo vector by PCR method. The primer sequences are as follows:
[0049] P1: 5'LTR-F CGG TGAAAGGATGAAAATGCAACCT (sequence 1 in the sequence listing)
[0050] P2: 5'LTR-R ATCTCGGTGGAACCTCCATGAAAGGCCAGTCGA (sequence 2 in the sequence listing)
[0051] P3: ψ-F CTCGACTGGCCTTTCATGGAGGTTCCACC...
Embodiment 2
[0063] Embodiment 2, construction of expression plasmid PM-1-GFP-21
[0064] According to the sequence of the GFP gene coding region, Xho I and Bgl II restriction sites were respectively introduced to synthesize primers. The primer sequences and the conditions of polymerase chain reaction (PCR) were as follows:
[0065] P15: GFPXho I CCG CCATGGTGAGCAAGGGCGA
[0066] P16: GFPBgl II GGA TTACTTGTACAGCTCGTCCAT
[0067] The 50 μl reaction system includes: 0.5 μl cDNA (100 ng / μl), 1 μl each of primers R and F (20 μM), 4 μl dNTP (2.5 mM), 0.5 μl Super-L taq DNA polymerase (NEB Company), 5 μl 10×PCRBuffer, 38 μl sterile water. The reaction conditions are: denaturation at 94°C for 3 minutes; 30 cycles at 94°C for 30s, 54°C for 45s, 72°C for 1min30s, and 72°C for 7min. The GFP gene fragment amplified by PCR was detected by 1% agarose gel electrophoresis, and the results were as follows: Figure 8 As shown (a. DL2000 Marker, b. GFP gene 740bp), consistent with the expected result...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com