Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Sika deer identifying primer and method and application

An identification method, the technology of sika deer, applied in biochemical equipment and methods, microbiological measurement/inspection, DNA/RNA fragments, etc., can solve the problems of identification, the authenticity of deer antler products, etc., and achieve the effect of reliable standardization

Inactive Publication Date: 2018-06-12
SHENZHEN INST FOR DRUG CONTROL SHENZHEN TESTING CENT OF MEDICAL DEVICES
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] However, the authenticity of a large number of velvet products on the market is not used, and there are difficulties in identification. A fast, ideal and reliable standardized and standardized identification method is urgently needed

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Sika deer identifying primer and method and application
  • Sika deer identifying primer and method and application
  • Sika deer identifying primer and method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Establishment of rapid detection of sika deer nucleic acid by LAMP method

[0042] 1 Experimental protocol

[0043] 1.1 Materials

[0044] 12 antler samples (0740, 0741, 0742, 0743, 0744, 0745, 0746, 0747, 0748, 0749, 0750, 0751) were purchased from the market, among which, 0748 was a red deer sample, 0749 was a reindeer sample, and added Serum samples from pigs, ducks, chickens, and bovines are used as samples to be tested.

[0045] 1.2 Instruments and reagents

[0046] LAMP method ribonucleic acid amplification kit (DNA Amplification Kit), EIKEN CHEMICAL CO., LTD, Tochigi, Japan;

[0047] LAMP reaction tube (Reaction Tube), Japan Eiken Chemical Co., Ltd.;

[0048] Visible dye (Te), Beijing Haitai Zhengyuan Biotechnology Co., Ltd.

[0049] Real-time turbidimeter La-320C, Japan Eiken Chemical Co., Ltd.

[0050] 1.3 Method

[0051] 1.3.1 Preparation of Target template target template

[0052] The target template was obtained by extracting nucleic acids from 12 ve...

Embodiment 2

[0182] Sensitivity test.

[0183] In order to verify the detection sensitivity of the above method, the nucleic acid of the extracted sample 0743 (concentration: 76ng / μl) was diluted 10 times, and a total of 7 dilution gradients (sample 0743, 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 and 10 -7 ), and double distilled water was used as negative control. Then carry out LAMP reaction according to the method of embodiment 1, adopt turbidity method and Te to detect result.

[0184] The result is as image 3 As shown, LAMP can detect the sixth dilution of sample 0743, and the results of the turbidimetric method are consistent with those of the staining method. Therefore, although the reaction time of the LAMP amplification system is slightly slower, the sensitivity is excellent (because it can detect To the sixth dilution), it is 0.076pg / μl, the sensitivity is enough to meet the actual detection, and the amplification constant temperature time is preferably 65min.

Embodiment 3

[0186] Optimal temperature screening.

[0187] Screen the primers at the optimum temperature, the temperature is from 59-66° C. with a gradient of 1° C., then carry out the LAMP reaction according to the method of Example 1, and use the turbidity method to detect the result.

[0188] Test results such as Figure 4 As shown, it can be seen from the figure that the LAMP reaction occurs first at 60°C, 61°C, and 62°C, and the preferred temperature is 61°C.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a sika deer identifying primer and method and application, and belongs to the technical field of species identification. The identifying primer comprises an inner primer FIP:TGTCCTATACACCGATTTATGTGCTGCAAAACACGTGATATAACCT, an inner primer BIP: TGCCCCATGCTTATAAGCATGTGTACGATGAACAACATCATG, an outer primer F3: TCTATGTCCTACTAATTACAC, an outer primer B3: GACTGATTTGACTTAATGCAC, aloop primer LF: ACACGTGTGTCTTAATGTAC, and a loop primer LB: TCCTATCATTTATAGTACATAGT. By the primer, sika deer nucleic acid can be specifically amplified rapidly, and the bottleneck difficulty on identifying cartialgenous.

Description

technical field [0001] The invention relates to the technical field of species identification, in particular to a sika deer identification primer, method and application. Background technique [0002] Antler refers to the unossified and hairy young horns of the sika deer, which is a valuable medicinal material. Antler contains phospholipids, glycolipids, gelatin, hormones, fatty acids, amino acids, proteins, calcium, phosphorus, magnesium, sodium and other ingredients, of which amino acids account for more than half of the total ingredients. Li Shizhen said in "Compendium of Materia Medica" that velvet antler is "good at nourishing kidney and strengthening yang, producing essence and blood, nourishing marrow and strengthening bones", and is a traditional precious Chinese medicine. [0003] However, the authenticity of a large number of antler products on the market is not used, and there are difficulties in identification. A fast, ideal and reliable standardized and standar...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6888C12Q1/6844C12N15/11
CPCC12Q1/6844C12Q1/6888C12Q2531/119C12Q2545/113
Inventor 苏畅王淑红关潇滢王洋刁璇王铁杰鲁艺
Owner SHENZHEN INST FOR DRUG CONTROL SHENZHEN TESTING CENT OF MEDICAL DEVICES
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com