31results about How to "Strong standardization" patented technology

The invention discloses a hardware equipment automation testing system and a testing method thereof. The hardware equipment automation testing system comprises a test logic module, a general utility module, an external program calling module, a network protocol module and a GUI (graphical user interface) automation module. The test logic module comprises tools for realizing various test logics and combining tools in other modules into the complete test flow. The general utility module comprises general tools for implementing test steps during testing. The external program calling module comprises an external program used for calling compiling of various languages. The network protocol module is used for realizing automation in writing and reading of various network protocols. The GUI automation module is utilized for realizing automation of operations of various graphical user interfaces. According to the hardware equipment automation testing system and the testing method thereof, different modules/tools for realizing automation of testing steps are provided, different software and hardware resources can be combined in the same system, and accordingly automation of the test flow is realized.

The invention discloses a traceable batch preparation method of dried tangerine peel. The traceable batch preparation method of the dried tangerine peel comprises the following steps: S1, preliminary choosing tangerine fruits, checking the chosen tangerine fruits, boxing up the checked tangerine fruits, and then, sealing and labeling the boxes for the first time; S2, performing batch cleaning and sorting on the tangerine fruits on cleaning and sorting line equipment; S3, peeling the sorted tangerine fruits; S4, drying the tangerine peel in a drying device; S5, sealing and labeling the boxes of tangerine peel for the second time, and transferring the tangerine peel into a storage warehouse so as to prepare for aging. The step S5 comprises the following steps: S51, storing the tangerine peel in a standard warehouse for 2-5 months; S52, transferring the tangerine peel into a humidifying chamber so as to carry out first humidifying; S53, transferring the humidified tangerine peel into a wet-pumping and air-drying chamber so as to carry out first wet-pumping and air-drying; S54, transferring the wet-pumped and air-dried tangerine peel into the standard warehouse again, and storing the tangerine peel for 1 year; S55, performing second humidifying on the tangerine peel; and S56, performing second wet-pumping and air-drying on the humidified tangerine peel, so that the dried tangerine peel is prepared. The method disclosed by the invention realizes batch preparation of the dried tangerine pee; moreover, information of the tangerine fruits, including place of origin, householder, grade and so on, is traceable.

The invention discloses a refrigerating or heating equipment management system and method based on internet of things. The refrigerating or heating equipment management system based on the internet of things comprises a data collecting terminal and a server; and the refrigerating or heating equipment management system based on the internet of things is characterized in that the server comprises a model generating module, a monitoring or controlling parameter generating module, a data receiving and sending module and a database; and after the model generating module generates a refrigerating or heating module, the monitoring or controlling parameter generating module generates a monitoring or controlling parameter or a monitoring or controlling parameter instruction and sends the monitoring or controlling parameter or the monitoring or controlling parameter instruction to the data collecting terminal, the data collecting terminal collects data and feeds back the collected data to the server after collecting is conducted. According to the refrigerating or heating equipment management system and method based on the internet of things, monitoring or controlling management can be conducted on various kinds of refrigerating or heating, the universality is high, a user can choose according to the actual condition of equipment needing to be monitored and managed by the user, individuation management of the specific equipment is achieved, and moreover, the purpose that one set of system conducts monitoring or controlling management on multiple refrigerating or heating equipment is achieved.

The invention discloses a connecting piece. The first end of the connecting piece has a first card head and/or a first card slot, and the second end has a second card slot and a second card slot detachably matched with the above-mentioned first end. /or the second clamping head; the connecting piece also includes a clamping portion, the clamping portion extends between the first end and the second end of the connecting piece along the axis of the connecting piece, and the clamping portion is configured to be clamped fixed on the connected part. The invention also discloses an assembly and an assembly method, mainly aiming at the difficult problem of splicing and forming technology among various boards in furniture, toys, and interior decoration, a set of simple and easy-to-use connectors is designed to replace the traditional mortise and tenon structure, It has the advantages of simple processing, high precision, strong standardization and convenient assembly and disassembly of products.

The invention discloses a novel feeding device. The novel feeding device comprises a material bin, a wheel body and a feeding groove. The wheel body is arranged to be tangent to the bottom of the material bin, the wheel body is driven to rotate by a first driving unit, a plurality of blades are distributed in an inner cavity of the wheel body, and a stirring cavity is formed in the inner cavity among the blades. The feeding groove is fixedly formed in the stirring cavity, meanwhile, the feeding groove extends towards the feeding position, and the feeding groove is driven to feed materials by a second driving unit. Compared with the prior art, the manufacturing cost is lowered, and the universality of the novel feeding device is also strengthened.

The invention provides a method for using an amino acid analyzer to determine the tranexamic acid content. The method for determining the tranexamic acid content through ion exchange chromatography and a standard curve method is used. The chromatographic conditions are a 4-micron prewash column and an 8-micron analytical column. Ion exchange resin is resin dedicated to the Biochrom30+ high efficiency amino acid automatic analyzer. The detection wavelength is 570nm. The pump flow rate is 35ml/h. A gradient elution procedure comprises a 0 to 1min buffer 1, a 1 to 2min buffer 2, a 2 to 20min buffer 5, a 20 to 21.5min buffer 6 and a 21.5 to 23.5min buffer 1. The column temperature is 44 DEG C. The reaction temperature is 135 DEG C. The injection volume is 20 mu l. The amino acid analyzer usedfor determining the tranexamic acid content has the characteristics of high commercialization and automation. The method for determining the tranexamic acid content by using the amino acid analyzer has the advantages of simple operation, strong standardization, high sensitivity, being fast and efficient and the like.

The invention provides a standardized load-bearing support and hanger system and an installation method thereof. The standardized load-bearing support and hanger system comprises a top transverse beamand a hanging bracket. The hanging bracket comprises vertical arms and a cross arm. The tops of the vertical arms are fixedly connected to the lower side of the hanging bracket through bases. The twoends of the transverse arm are fixedly connected with the vertical arms through angle connection assemblies. The vertical arms or the transverse arm is formed by a section of channel steel standard component or formed by two sections of channel steel standard components through a lengthening connection assembly in a lengthening manner. Each channel steel standard component comprises a channel bottom plate, channel side plates and channel side flanges. A channel steel tooth is arranged on the top end face of each parallel flange. Each base comprises a horizontal connection plate and an outer sleeve. A tooth plate is inserted in each vertical arm. The outer sides of the tooth plates abut against the channel side flanges. Tooth plate clamping teeth and the channel steel teeth are clamped andfixed. Tooth plate connection holes and outer sleeve connection holes are right opposite and connected through first connection bolts. According to the standardized load-bearing support and hanger system and the installation method, standardized design is conducted for the load-bearing support and hanger system, and connection of all the standardized components is achieved through biting of the tooth plates and the channel steel teeth and then through bolt and connection piece fastening.

The invention relates to a nutritional composition for improving bone joint health as well as a preparation method and application thereof. The nutritional composition for improving bone joint healthcomprises the following components in parts by weight: 5 to 30 parts of chicken sternal cartilage powder, 0.5 to 3 parts of dimethyl sulfone, 0.1 to 2 parts of rhizoma curcumae longae, 0.1 to 2 partsof frankincense, 0.1 to 2 parts of myrrh and 0.5 to 2 parts of vitamin mixture. The nutritional composition for improving bone joint health achieves the effects of improving joint pain, relieving articular cartilage degeneration and improving athletic ability through combination of the chicken sternal cartilage powder and other active components.

The invention provides an oil and gas transport pipeline safety margin and residual life online monitoring platform featured by comprising the following parts: a data acquisition module used for acquiring oil and gas transport pipeline related data information for assisting a decision module to make decisions; the decision module used for determining evaluation rules according to the data providedby the data acquisition module, wherein the evaluation rules comprise ASME B31G evaluation rules, DNV_RP-F101 evaluation rules, and API-579 evaluation rules; an evaluation module used for estimatingthe oil and gas transport pipeline residual strength and life according to the evaluation rules determined by the decision module. The online monitoring platform can realize synergy evaluation of various evaluation rules, can provide reliable data support for safety evaluation personnel to make correct evaluations, and comprises database technology, safety evaluation technology and assistance decision technology; the platform is stable, safe, practical, and expandable.

The invention discloses a reinforcing rib making die for a ribbed superposed concrete prefabricated member. The die comprises a first template and a second template which are arranged corresponding to each other; the sections of the first template and the second template respectively consist of a vertical plate body and a horizontal plate body positioned at the lower part of the vertical plate body and are L-shaped; a first elastic lining film and a second elastic lining film are respectively arranged on the inside walls of the first template and the second template; the mutually corresponding edges of the first lower lining film and the second lower lining film are respectively concave-convex; a first baffle plate and a second baffle plate are respectively arranged between the first template and the second template and are respectively in contact with the first elastic lining film and the second elastic lining film; the first baffle plate is provided with a first steel bar hole and asecond steel bar hole; and the second baffle plate is provided with a third steel bar hole and a fourth steel bar hole. The die has the remarkable characteristics of standardization, strong interchangeability, simplicity and convenience in disassembly and assembly, no need of die release treatment and capability of meeting industrialized production of concrete prefabricated members.

The invention discloses a slow-release pellet feed used in a rapid growth period of south-moving stichopus japonicus. The slow-release pellet feed is characterized by being prepared by mixing the following components in percentage by mass: 40-50% of a protein component composition, 6-8% of a grease component composition, 15-25% of a starch component composition, 0.5-0.6% of compound vitamins, 0.7-0.8% of compound mineral salt, 20-25% of a functional component composition and 1.0-1.5% of a biological adhesive.

The invention provides an animal experiment platform. The animal experiment platform is composed of a top wall, four side walls (12) and a cabin bottom, and further comprises a reflective heat insulation film (1), a humidifying pipe (2), an upper heating plate (3), a transfer window (4), a cabin door (5), an animal running platform (6), a lower heating plate (7), a flat car (8) and a humidifier water tank (9), an inner cabin (10), a drain pipe (11), a temperature controller (13) and an electronic temperature and humidity meter (14). The animal experiment platform can simulate a high-temperature and high-humidity environment, can provide a certain strength of labor training for experimental animals (rats and mice), can successfully replicate an experimental animal model of exertional heatstroke (EHS), is convenient to operate, strong in practicability, accurate, stable, high in standardization, simple, universal and good in repeatability.

The invention discloses a geomembrane laying system and a laying method. The geomembrane laying system comprises a transportation track, a gantry feeding work vehicle, a construction laying work vehicle and a feeding vehicle, wherein the transportation track is arranged above a to-be-laid working face; the gantry feeding work vehicle is arranged on one end of the transportation track; the construction laying work vehicle is arranged on the transportation track in a sliding mode so as to lay a support layer, a geomembrane and a protective layer on the to-be-laid working face; and the feeding vehicle is arranged on the transportation track in a sliding mode so as to convey to-be-laid materials from the gantry feeding work vehicle to the construction laying work vehicle. According to the geomembrane laying system, the labor input of geomembrane laying operation can be reduced, the construction cost is reduced, and the construction quality and the construction efficiency are improved.

The invention relates to a panel system (3), comprising a plurality of fixed panels (1) and a plurality of openable panels (2). Each fixed panel (1) and each openable panel (2) comprise a frame structure consisting of a set of profile elements (11, 12, 13, 14, 21, 22, 23, 24) surrouding panel elements (5; 15; 15'), and said frame structure comprises a top profile element (11, 21) configured to be connected to a support structure by means of a mounting and hinge assembly. The mounting and hinge assembly comprises a mounting profile (9) and a hinge (25), and the hinge (25) is configured as a connecting element between the mounting profile (9) and the top profile elements (11, 21) of each fixed panel (1) and each openable panel (2).

The invention relates to a sika deer identifying primer and method and application, and belongs to the technical field of species identification. The identifying primer comprises an inner primer FIP:TGTCCTATACACCGATTTATGTGCTGCAAAACACGTGATATAACCT, an inner primer BIP: TGCCCCATGCTTATAAGCATGTGTACGATGAACAACATCATG, an outer primer F3: TCTATGTCCTACTAATTACAC, an outer primer B3: GACTGATTTGACTTAATGCAC, aloop primer LF: ACACGTGTGTCTTAATGTAC, and a loop primer LB: TCCTATCATTTATAGTACATAGT. By the primer, sika deer nucleic acid can be specifically amplified rapidly, and the bottleneck difficulty on identifying cartialgenous.