Supercharge Your Innovation With Domain-Expert AI Agents!

Method of utilizing Tnt1 retrotransposon with controllable inducible expression and re-transposition loss to establish plant mutant library

A technology for inducing expression and mutants, applied in plant gene improvement, botanical equipment and methods, and using vectors to introduce foreign genetic material, etc., can solve the problems of increasing insertion mutation sites, scientific research and production applications are difficult to judge

Inactive Publication Date: 2018-06-29
NORTHWEST A & F UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Nonsensical and uncontrollable transposition will lead to the addition of new insertion mutation sites, resulting in difficult-to-judge results for subsequent scientific research and production applications

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0014] Construct a Tnt1 retrotransposon vector for inducible expression, remove the sequence before TATA four bases in the AAGCTTTGGCTATAAAAGGAGAGC sequence in the first repeat region of the tobacco Tnt1 retrotransposon sequence, and combine it with the induced expression TATA sequence fusion in the promoter.

[0015] Further modify the Tnt1 retrotransposon sequence, and mutate the four bases of TATA in the middle AAGCTTTGGCTATAAAAGGAGAGC sequence of the second repeat region of the tobacco Tnt1 retrotransposon sequence to CATA, CACA and other results that are different from the original bases , and avoid TATAWAW sequences within +-20bp.

[0016] Through the specific transgenic method for different plants, the DNA fragments are transferred into the plant genome, and the plants containing the designed sequence in the genome are screened.

[0017] The genomic DNA of the transgenic plants obtained in the previous step was subjected to two rounds of TAIL-PCR using insertion T-DNA ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method of utilizing a Tnt1 retrotransposon, which is established based on controllable inducible expression and does not have any re-transposition performance after one-timetransposition to establish a plant mutant library. The method is characterized in that the sequence before TATA (four bases) of the AAGCTTTGGCTATAAAAGGAGAGC sequence of the first repeat area of the tobacco Tnt1 retrotransposon sequence is eliminated, and the modified sequence is fused with the TATA sequence of an inducible expression promoter; and the TATA (four bases) of the AAGCTTTGGCTATAAAAGGAGAGC sequence of the second repeat area of the tobacco Tnt1 retrotransposon sequence are mutated to remove the functions. The invention aims to provide a method, which can rapidly establish a reliablemutant library through simple manual control and only using sexual reproduction; and the method can satisfy the requirements of genetic research of crops and crop breeding and can be applied to scientific research on crops.

Description

technical field [0001] The invention relates to a method for constructing a plant mutant library, in particular to a method for constructing a plant mutant library using a modified Tnt1 retrotransposon that is controllably induced and expressed and lacks retransposition ability, and belongs to the field of biotechnology . Background technique [0002] With the continuous development of plant molecular biology techniques, the application of mutants is becoming more and more extensive. At present, the main methods for constructing plant mutant libraries include somaclonal mutation, physical mutagenesis, chemical mutagenesis, and biological mutagenesis. The mechanisms and characteristics of these four mutagenesis methods are different (Larkin and Scowcroft, 1981; Li Xiaoling et al., 2008; Niu Yanli et al., 2009; Guo Jianqiu et al., 2010; Xu Ming and Lu Tiegang, 2011; Fan Shuanghu et al., 2014); Among them, biological mutagenesis is currently widely used. [0003] Biological m...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/82A01H1/02
CPCC12N15/8237A01H1/02
Inventor 刘金隆沙煦旸曾引伟王瑞华杨培志呼天明席杰军
Owner NORTHWEST A & F UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More