44 results about "Retrotransposon transposition" patented technology

Disclosed and claimed are methods of non-invasive genetic immunization in an animal and/or methods of inducing a systemic immune or therapeutic response in an animal, products therefrom and uses for the methods and products therefrom. The methods can include contacting skin of the animal with a vector in an amount effective to induce the systemic immune or therapeutic response in the animal. The vector can include and express an exogenous nucleic acid molecule encoding an epitope or gene product of interest. The systemic immune response can be to or from the epitope or gene product. The nucleic acid molecule can encode an epitope of interest and/or an antigen of interest and/or a nucleic acid molecule that stimulates and/or modulates an immunological response and/or stimulates and/or modulates expression, e.g., transcription and/or translation, such as transcription and/or translation of an endogenous and/or exogenous nucleic acid molecule; e.g., one or more of influenza hemagglutinin, influenza nuclear protein, influenza M2, tetanus toxin C-fragment, anthrax protective antigen, anthrax lethal factor, rabies glycoprotein, HBV surface antigen, HIV gp 120, HIV gp 160, human carcinoembryonic antigen, malaria CSP, malaria SSP, malaria MSP, malaria pfg, and mycobacterium tuberculosis HSP; and/or a therapeutic, an immunomodulatory gene, such as co-stimulatory gene and/or a cytokine gene. The immune response can be induced by the vector expressing the nucleic acid molecule in the animal's cells. The animal's cells can be epidermal cells. The immune response can be against a pathogen or a neoplasm. A prophylactic vaccine or a therapeutic vaccine or an immunological composition can include the vector. The animal can be a vertebrate, e.g., a mammal, such as human, a cow, a horse, a dog, a cat, a goat, a sheep or a pig; or fowl such as turkey, chicken or duck. The vector can be one or more of a viral vector, including viral coat, e.g., with some or all viral genes deleted therefrom, bacterial, protozoan, transposon, retrotransposon, and DNA vector, e.g., a recombinant vector; for instance, an adenovirus, such as an adenovirus defective in its E1 and/or E3 and/or E4 region(s). The method can encompass applying a delivery device including the vector to the skin of the animal, as well as such a method further including disposing the vector in and/or on the delivery device. The vector can have all viral genes deleted therefrom. The vector can induce a therapeutic and/or an anti-tumor effect in the animal, e.g., by expressing an oncogene, a tumor-suppressor gene, or a tumor-associated gene. Immunological products generated by the expression, e.g., antibodies, cells from the methods, and the expression products, are likewise useful in in vitro and ex vivo applications, and such immunological and expression products and cells and applications are disclosed and claimed. Methods for expressing a gene product in vivo and products therefor and therefrom including mucosal and/or intranasal administration of an adenovirus, advantageously an E1 and/or E3 and/or E4 defective or deleted adenovirus, such as a human adenovirus or canine adenovirus, are also disclosed and claimed.

TCa2 is a Tyl/copia retrotransposon from the pathogenic yeast Candida albicans. In contrast to other retrotransposons it can appear as an abundant, extrachromosomal double-stranded DNA molecule, called pCal. The invention relates to the isolation and characterisation of TCa2 and pCal together with its uses for inducing random mutagenesis in a genome, as a component of a transposable element and of an expression vector.

The invention discloses a method for detecting viable Listeria monocytogene, relating to a method for detecting Listeria. The invention solves the problem that the prior method for detecting viable Listeria monocytogenes is easy to produce false positive. The method for detecting viable Listeria monocytogenes is carried out as following steps: after extracting bacterial sludge from articles to be detected, extracting RNA to implement retrotransposon and real time PCR; accordingly, a collection of illustrative plates which are capable of determining whether the articles contain viable Listeria monocytogenes or not. The method has the advantages of high sensitivity, good specificity, simple operation, and comparatively short period. The method meets the requirements of pathogen rapid detection in food industry.

A novel mini-retrotransposon vector system is provided for integrating foreign DNA into plants. The invention includes a novel vector comprising a truncated and modified retroelement which includes the 5′ and 3′ LTR regions that provide transcription initiation and termination sites as well as the cis acting sequences required for reverse transcription. Novel vectors, plant cells, and methods of using the same are disclosed.

A process of quantifying the extent of degradation present in a human DNA sample is described. The process makes use of a real time PCR system to separately quantitate within a sample a first retrotransposon interspersed element and a relatively longer second retrotransposon interspersed element, where the longer element is expected to be disrupted at a faster pace than is the shorter element as the sample degrades. In one embodiment, the process makes use of the appearance of the relatively young (on an evolutionary scale) Alu Yb-lineage subfamily sequences appearing in every human genome and their virtual absence in non-human samples. In a preferred embodiment, the process quantifies longer 290 bp sequences of “SVA” elements and shorter 80 bp sequences of Alu Yb8-lineage. Newly designed primers and TaqMan probes that are useful in the process are presented. A related process additionally quantifies male specific human DNA.

The invention discloses a PCR detection and identification method capable of distinguishing pyricularia grise and magnaporthe oryzae and belongs to the technical field of plant fungus molecule biological detection. The PCR detection and identification method includes the steps of A, extracting DNA, to be specific, respectively extracting DNA of pyricularia grise and magnaporthe oryzae; B, designing primers, to be specific, designing a pair of specific primers Mol3-F/Mol3-F by inserting two ends of the retrotransposon of 849bp into a coding region of avirulence gene PWL3 of pyricularia grise; C, performing PCR, to be specific, performing PCR amplification by taking the extracted total DNA of pyricularia grise and magnaporthe oryzae as a template, so as to obtain an amplification product; D,determiningresults, to be specific, subjecting the amplification product to electrophoresis detection, if a target band of 1771bp is detected, then determining the product as pyricularia grise; if aband of 922bp is detected, then determining the product as magnaporthe oryzae. The PCR detection and identification method can rapidly accurately distinguish pyricularia grise and magnaporthe oryzae which are difficult to distinguish, and has a great significance in field spreading, breeding and evolving of Pyricularia on natural conditions.

By utilizing a Mini-Primer strategy targeting the target site duplication (TSD) sequence of retrotransposons, insertion and null allele (INNUL) markers, which include short interspersed nuclear elements (SINEs), long interspersed nuclear elements (LINEs), and composite SVA retrotransposons (SINE/VNTR/Alu, where VNTR represents “variable number of tandem repeats” and Alu represents a type of primate specific SINE that has reached a copy number in excess of one million in the human genome), can be effectively used as markers for human identification and bio-ancestry studies regardless of the size of the inserted element. The size of the amplicons for INNULs and the difference between allelic states can be reduced substantially such that these markers have utility for analyzing high and low quality human DNA samples. Multiplexes including either 15 or 20 retrotransposable element (RE) markers plus Amelogenin for single tube amplification of DNA in four color detection were successfully designed. The multiplexes provided power of discrimination suitable for forensic and paternity analyses.

The cauliflower (Brassica oleracea L. var. botrytis) Or gene is a semi-dominant, single-locus mutation. It induces the accumulation of high levels of beta-carotene in various tissues that are normally devoid of carotenoids, turning them orange. Using a map-based cloning strategy, we identified a single gene representing Or and successfully verified its identity by functional complementation in the wild type cauliflower. The Or gene encodes a plastid membrane protein containing the DnaJ zinc figure domain. A likely gain-of-function mutation from a 4.3-kb retrotransposon insertion in the Or allele confers the orange phenotype in the mutant. Southern blot analysis revealed that Or is a single-copy sequence in the cauliflower genome. High level of expression of the Or gene and the protein was found in very young leaves, curds, and flowers at comparable abundance between wild type and the Or mutant. Or likely functions in regulating the differentiation of some non-photosynthetic plastids into chromoplasts, which provide the deposition “sink” for carotenoid accumulation. Successful demonstration of Or in conferring carotenoid accumulation in potato tubers indicates its potential use to improve the nutritional value in staple crops.

The invention relates to nucleic acids, vector constructs which allow the controlled activation and inhibition of retrotransposition of non-LTR retrotransposons. The methods of this invention are useful for preparing said nucleic acids and vector constructs and introducing them into cells.

The invention discloses application of a DNA target sequence of schistosoma japonicum retrotransposon in schistosomiasis diagnosis and particularly provides retrotransposon shown by any one nucleotide sequence selected from SEQ ID NO:1-25 and can be used as a detection marker for schistosomiasis. The invention also provides a pair of primers for specifically amplifying the retrotransposon sequence.

The present invention discloses an agropyron cristatum centromere specific Gypsy retrotransposon sequence and application thereof, and an agropyron cristatum centromere specific Gypsy retrotransposon is (a) or (b): (a) is a DNA molecule shown as 37th-803th site nucleotides from 5 'end of a sequence 1, or (b) is a DNA molecule shown as the sequence 1. The present invention also provides a specific primer pair comprising a single-stranded DNA molecule shown as a sequence 2 of a sequence table and a single-stranded DNA molecule shown as a sequence 3 of the sequence table. Significances are as follows: (1) acquisition of centromeric retrotransposon pAcCR1 has an important role for the study of agropyron plant evolution; (2) due to acquisition of a large number of wheat-agropyron cristatum translocation lines, new challenges for rapid detection of exogenous chromatin in agropyron cristatum are put forward, and P chromatin of a centromeric region of the agropyron cristatum under wheat background can be efficiently detected on the basis of acquisition of a retrotransposon specific molecular marker of a P genome centromeric region.

To comprehensively modify genome, it is intended to develop a transposition system of the copy and paste type which has an improved efficiency. This object has been achieved by the finding that an LTR retrotransposon is partly usable in a transposition system. Namely, a technique of efficiently transferring a foreign gene into a cell by using a transposon. More specifically speaking, a complete IPA element and a functional promoter sequence are found out. It is clarified that, without a combination of them, a retrotransposon cannot exert its function.

The invention discloses a saccharum spontaneum retrotransposon sequence and an identification method of the saccharum spontaneum retrotransposon sequence. Four saccharum spontaneum retrotransposon sequences are screened out using cluster analysis of genome data of saccharum spontaneum and a tropical species; primers are designed separately according to the sequences for amplification to form a full-length sequence; then, a probe is prepared; fluorescence in situ hybridization (FISH) identification is performed on metaphase chromosomes of the saccharum spontaneum and the tropical species; and aresult shows that the four retrotransposon sequences generate clear and bright signals on the saccharum spontaneum chromosomes. The retrotransposon sequence can be directly used for specific identification of the saccharum spontaneum chromosomes, provides more accurate information for blood relationship identification of the saccharum spontaneum in cultivated sugarcane varieties, and lays a foundation for chromosome engineering breeding of sugarcane.

The invention relates to a pig genome molecular marker excavation method based on combination of LINE1 transposon and a microsatellite primer. The method uses a 5'-terminal nucleotide sequence or a 3'-terminal nucleotide sequence of LINE1 to design a specific primer; according to bioinformatic analysis, the microsatellite sequences widely distributed in the pig genome are obtained to design the microsatellite primer; two primers are combined, and the different types of the pig genomes can be taken as a template for amplification; an amplification strip having clearness, high polymorphism and good repeatability is screened, and clone sequencing is carried out; a sequencing result is subjected to comparative analysis, combination of a side specific primer and a retrotransposon LINE1 specificprimer can be designed, a to-be-verified molecule-labeled primer is used for PCR amplification of different types of individual genome samples, the primer combination capable of clearly amplifying the strip and having polymorphism can be selected, and the molecular marker can be obtained. The method can provides the useful molecular marker for marker auxiliary selection in pig lines identification and breeding.

The present invention relates to a method for disrupting a gene in a plant using a tobacco retrotransposon, comprising the steps of introducing the retrotransposon into the plant, and culturing and regenerating the plant, into which the retrotransposon is introduced, to produce a transformed plant.

The invention discloses a retrotransposon promoter PCb-RARE induced by high salt and salicylic acid and application of the retrotransposon promoter PCb-RARE. The promoter is derived from an LTR region of Carallia brachiata retrotransposon Cb-RARE-1, and is shown as SEQ ID NO: 1. A recombinant expression vector which contains the promoter and GUS gene is converted into Arabidopsis, the promoter is proved to be inducted of NaCl and the salicylic acid, and the promoter can be used for screening of saline-alkali tolerant plants and molecular breeding by using the characteristic. The inducible promoter is used for inducing foreign gene to be expressed in a plant, and the promoter function can be activated or suppressed by stimulation of the high salt or the salicylic acid, so that gene expression can be activated or suppressed by using high-concentration sodium chloride or salicylic acid in specific time or in a growth stage, synthesis of gene products can be controlled, and the growth of the plant can be adjusted on purposes.

The invention discloses a P genome specific Gypsy retrotransposon and application thereof. P genome specific Gypsy retrotransposon provided by the invention is as shown in either (a) or (b), wherein (a) refers to a DNA molecule shown as nucleotides on the 531st-1575th sites from 5' end of a sequence 1; and (b) refers to a DNA molecule as shown in the sequence 1. The invention also protects a specific primer pair composed of a single-stranded DNA molecule as shown in a sequence 2 in a sequence list and a single-stranded DNA molecule as shown in a sequence 3 in the sequence list. The Gypsy retrotransposon and the application thereof disclosed by the invention have the following significances: (1) the acquisition of an interspersed repetitive sequence pAcPR1 is important for researching the evolution of agropyron plants; and (2) the acquisition of a great amount of wheat-agropyron translocation lines brings a new challenge for the rapid detection of exogenous agropyron chromatins; and the acquisition of a specific molecular marker based on the P genome retrotransposon is conductive to the efficient detection of the agropyron chromatins on the background of wheat.

The invention discloses a cyprinus carpio retrotransposon marker. A high-polymorphism retrotransposon REMAP marker of cyprinus carpio is developed by predicting and identifying a cyprinus carpio retrotransposon sequence, screening a cyprinus carpio polymorphism REMAP marker and performing genetic polymorphism detection on a cyprinus carpio retrotransposon locus. The cyprinus carpio retrotransposon marker disclosed by the invention can be applied to the research on the population genetic structure, genetic variation level and the like of the cyprinus carpio population and the germplasm identification of the geographical population of cyprinus carpio.

By utilizing a Mini-Primer strategy targeting the target site duplication (TSD) sequence of retrotransposons, INNUL markers, which include SINEs, LINEs, and SVAs, can be effectively used as markers for human identification and bio-ancestry studies regardless of the size of the inserted element. The size of the amplicons for INNULs and the difference between allelic states can be reduced substantially such that these markers have utility for analyzing high and low quality human DNA samples. A 15 RE marker and Amelogenin (for sex determination) multiplex for a single tube amplification of DNA, in four color detection was successfully designed. The multiplex provided power of discrimination suitable for forensic and paternity analysis. In addition, sensitivity of detection can enable human identity and bio-ancestry studies on forensic and anthropological samples. Depending on the distribution of the alleles in global populations, INNULs can be selected for human identity testing or for bio-ancestry studies.

The invention discloses a method of utilizing a Tnt1 retrotransposon, which is established based on controllable inducible expression and does not have any re-transposition performance after one-timetransposition to establish a plant mutant library. The method is characterized in that the sequence before TATA (four bases) of the AAGCTTTGGCTATAAAAGGAGAGC sequence of the first repeat area of the tobacco Tnt1 retrotransposon sequence is eliminated, and the modified sequence is fused with the TATA sequence of an inducible expression promoter; and the TATA (four bases) of the AAGCTTTGGCTATAAAAGGAGAGC sequence of the second repeat area of the tobacco Tnt1 retrotransposon sequence are mutated to remove the functions. The invention aims to provide a method, which can rapidly establish a reliablemutant library through simple manual control and only using sexual reproduction; and the method can satisfy the requirements of genetic research of crops and crop breeding and can be applied to scientific research on crops.

The invention discloses a tobacco retrotransposon gene Ntrt1. The tobacco retrotransposon gene Ntrt1 has a nucleotide sequence represented by SEQ ID NO:1. A protein encoded by the gene is characterized in that the protein has amino acid sequences represented by SEQ ID NO:2, SEQ ID NO:3 and SEQ ID NO:4; and the protein is used for adjusting the height of tobacco plants.