Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

45 results about "Retrotransposon transposition" patented technology

The retrotransposons' replicative mode of transposition by means of an RNA intermediate rapidly increases the copy numbers of elements and thereby can increase genome size. Like DNA transposable elements (class II transposons), retrotransposons can induce mutations by inserting near or within genes.

Noninvasive genetic immunization, expression products therefrom, and uses thereof

InactiveUS6716823B1Improve vaccination schemeEfficient methodSsRNA viruses negative-senseBiocideMalariaNon invasive
Disclosed and claimed are methods of non-invasive genetic immunization in an animal and / or methods of inducing a systemic immune or therapeutic response in an animal, products therefrom and uses for the methods and products therefrom. The methods can include contacting skin of the animal with a vector in an amount effective to induce the systemic immune or therapeutic response in the animal. The vector can include and express an exogenous nucleic acid molecule encoding an epitope or gene product of interest. The systemic immune response can be to or from the epitope or gene product. The nucleic acid molecule can encode an epitope of interest and / or an antigen of interest and / or a nucleic acid molecule that stimulates and / or modulates an immunological response and / or stimulates and / or modulates expression, e.g., transcription and / or translation, such as transcription and / or translation of an endogenous and / or exogenous nucleic acid molecule; e.g., one or more of influenza hemagglutinin, influenza nuclear protein, influenza M2, tetanus toxin C-fragment, anthrax protective antigen, anthrax lethal factor, rabies glycoprotein, HBV surface antigen, HIV gp 120, HIV gp 160, human carcinoembryonic antigen, malaria CSP, malaria SSP, malaria MSP, malaria pfg, and mycobacterium tuberculosis HSP; and / or a therapeutic, an immunomodulatory gene, such as co-stimulatory gene and / or a cytokine gene. The immune response can be induced by the vector expressing the nucleic acid molecule in the animal's cells. The animal's cells can be epidermal cells. The immune response can be against a pathogen or a neoplasm. A prophylactic vaccine or a therapeutic vaccine or an immunological composition can include the vector. The animal can be a vertebrate, e.g., a mammal, such as human, a cow, a horse, a dog, a cat, a goat, a sheep or a pig; or fowl such as turkey, chicken or duck. The vector can be one or more of a viral vector, including viral coat, e.g., with some or all viral genes deleted therefrom, bacterial, protozoan, transposon, retrotransposon, and DNA vector, e.g., a recombinant vector; for instance, an adenovirus, such as an adenovirus defective in its E1 and / or E3 and / or E4 region(s). The method can encompass applying a delivery device including the vector to the skin of the animal, as well as such a method further including disposing the vector in and / or on the delivery device. The vector can have all viral genes deleted therefrom. The vector can induce a therapeutic and / or an anti-tumor effect in the animal, e.g., by expressing an oncogene, a tumor-suppressor gene, or a tumor-associated gene. Immunological products generated by the expression, e.g., antibodies, cells from the methods, and the expression products, are likewise useful in in vitro and ex vivo applications, and such immunological and expression products and cells and applications are disclosed and claimed. Methods for expressing a gene product in vivo and products therefor and therefrom including mucosal and / or intranasal administration of an adenovirus, advantageously an E1 and / or E3 and / or E4 defective or deleted adenovirus, such as a human adenovirus or canine adenovirus, are also disclosed and claimed.
Owner:UAB RES FOUND

Unusual retrotransposon from the yeast Candida albicans

TCa2 is a Tyl / copia retrotransposon from the pathogenic yeast Candida albicans. In contrast to other retrotransposons it can appear as an abundant, extrachromosomal double-stranded DNA molecule, called pCal. The invention relates to the isolation and characterisation of TCa2 and pCal together with its uses for inducing random mutagenesis in a genome, as a component of a transposable element and of an expression vector.
Owner:JANSSEN PHARMA NV

Method for checking monocyte hyperplasia Listeria

The invention discloses a method for detecting viable Listeria monocytogene, relating to a method for detecting Listeria. The invention solves the problem that the prior method for detecting viable Listeria monocytogenes is easy to produce false positive. The method for detecting viable Listeria monocytogenes is carried out as following steps: after extracting bacterial sludge from articles to be detected, extracting RNA to implement retrotransposon and real time PCR; accordingly, a collection of illustrative plates which are capable of determining whether the articles contain viable Listeria monocytogenes or not. The method has the advantages of high sensitivity, good specificity, simple operation, and comparatively short period. The method meets the requirements of pathogen rapid detection in food industry.
Owner:NORTHEAST AGRICULTURAL UNIVERSITY

Retroelement vector system for amplification and delivery of nucleotide sequences in plants

A novel mini-retrotransposon vector system is provided for integrating foreign DNA into plants. The invention includes a novel vector comprising a truncated and modified retroelement which includes the 5′ and 3′ LTR regions that provide transcription initiation and termination sites as well as the cis acting sequences required for reverse transcription. Novel vectors, plant cells, and methods of using the same are disclosed.
Owner:IOWA STATE UNIV RES FOUND

Development of a highly sensitive quantification system for assessing DNA degradation and quality in forensic samples

ActiveUS20140051075A1High sensitivitySimplified suppressionMicrobiological testing/measurementHuman DNA sequencingRetrotransposon transposition
A process of quantifying the extent of degradation present in a human DNA sample is described. The process makes use of a real time PCR system to separately quantitate within a sample a first retrotransposon interspersed element and a relatively longer second retrotransposon interspersed element, where the longer element is expected to be disrupted at a faster pace than is the shorter element as the sample degrades. In one embodiment, the process makes use of the appearance of the relatively young (on an evolutionary scale) Alu Yb-lineage subfamily sequences appearing in every human genome and their virtual absence in non-human samples. In a preferred embodiment, the process quantifies longer 290 bp sequences of “SVA” elements and shorter 80 bp sequences of Alu Yb8-lineage. Newly designed primers and TaqMan probes that are useful in the process are presented. A related process additionally quantifies male specific human DNA.
Owner:LIFE GENETICS LAB

PCR detection and identification method capable of distinguishing pyricularia grise and magnaporthe oryzae

The invention discloses a PCR detection and identification method capable of distinguishing pyricularia grise and magnaporthe oryzae and belongs to the technical field of plant fungus molecule biological detection. The PCR detection and identification method includes the steps of A, extracting DNA, to be specific, respectively extracting DNA of pyricularia grise and magnaporthe oryzae; B, designing primers, to be specific, designing a pair of specific primers Mol3-F / Mol3-F by inserting two ends of the retrotransposon of 849bp into a coding region of avirulence gene PWL3 of pyricularia grise; C, performing PCR, to be specific, performing PCR amplification by taking the extracted total DNA of pyricularia grise and magnaporthe oryzae as a template, so as to obtain an amplification product; D,determiningresults, to be specific, subjecting the amplification product to electrophoresis detection, if a target band of 1771bp is detected, then determining the product as pyricularia grise; if aband of 922bp is detected, then determining the product as magnaporthe oryzae. The PCR detection and identification method can rapidly accurately distinguish pyricularia grise and magnaporthe oryzae which are difficult to distinguish, and has a great significance in field spreading, breeding and evolving of Pyricularia on natural conditions.
Owner:GRAIN RES INST HEBEI ACAD OF AGRI & FORESTRY SCI

Method for genetic detection using interspersed genetic elements: a multiplexed DNA analysis system

ActiveUS20160108462A1Easy to produceSize andNucleotide librariesMicrobiological testing/measurementHuman DNA sequencingPaternity analysis
By utilizing a Mini-Primer strategy targeting the target site duplication (TSD) sequence of retrotransposons, insertion and null allele (INNUL) markers, which include short interspersed nuclear elements (SINEs), long interspersed nuclear elements (LINEs), and composite SVA retrotransposons (SINE / VNTR / Alu, where VNTR represents “variable number of tandem repeats” and Alu represents a type of primate specific SINE that has reached a copy number in excess of one million in the human genome), can be effectively used as markers for human identification and bio-ancestry studies regardless of the size of the inserted element. The size of the amplicons for INNULs and the difference between allelic states can be reduced substantially such that these markers have utility for analyzing high and low quality human DNA samples. Multiplexes including either 15 or 20 retrotransposable element (RE) markers plus Amelogenin for single tube amplification of DNA in four color detection were successfully designed. The multiplexes provided power of discrimination suitable for forensic and paternity analyses.
Owner:LIFE GENETICS LAB

Or gene and its use in manipulating carotenoid content and composition in plants and other organisms

InactiveUS20070199104A1Increase carotenoid contentSugar derivativesTransferasesBeta-CaroteneHigh level expression
The cauliflower (Brassica oleracea L. var. botrytis) Or gene is a semi-dominant, single-locus mutation. It induces the accumulation of high levels of beta-carotene in various tissues that are normally devoid of carotenoids, turning them orange. Using a map-based cloning strategy, we identified a single gene representing Or and successfully verified its identity by functional complementation in the wild type cauliflower. The Or gene encodes a plastid membrane protein containing the DnaJ zinc figure domain. A likely gain-of-function mutation from a 4.3-kb retrotransposon insertion in the Or allele confers the orange phenotype in the mutant. Southern blot analysis revealed that Or is a single-copy sequence in the cauliflower genome. High level of expression of the Or gene and the protein was found in very young leaves, curds, and flowers at comparable abundance between wild type and the Or mutant. Or likely functions in regulating the differentiation of some non-photosynthetic plastids into chromoplasts, which provide the deposition “sink” for carotenoid accumulation. Successful demonstration of Or in conferring carotenoid accumulation in potato tubers indicates its potential use to improve the nutritional value in staple crops.
Owner:UNITED STATES OF AMERICA AS REPRESENTED BY THE SEC OF AGRI THE

Application of DNA target sequence of schistosoma japonicum retrotransposon in schistosomiasis diagnosis

The invention discloses application of a DNA target sequence of schistosoma japonicum retrotransposon in schistosomiasis diagnosis and particularly provides retrotransposon shown by any one nucleotide sequence selected from SEQ ID NO:1-25 and can be used as a detection marker for schistosomiasis. The invention also provides a pair of primers for specifically amplifying the retrotransposon sequence.
Owner:CHINESE NAT HUMAN GENOME CENT AT SHANGHAI +1

Cleistogenes songorica LTR-RT molecular marker primer and application in cleistogenes songorica germplasm identification

The invention belongs to the technical field of biology, and particularly relates to a cleistogenes songorica LTR-RT (long-terminal repeat retrotransposons) molecular marker primer and application incleistogenes songorica germplasm identification. Specifically, 80 pairs of primer pairs and 23 kinds of cleistogenes songorica germplasm are used for distinguishing. According to the identification method, comparison and identification of the cleistogenes songorica germplasm can be completed within 4 hours by using few primer combinations, the advantages of being accurate, efficient, quick, low incost, convenient to operate and the like are achieved, and the sensitivity and accuracy are relatively high.
Owner:LANZHOU UNIVERSITY

Agropyron cristatum centromere specific Gypsy retrotransposon sequence and application thereof

ActiveCN105441428AEfficient detectionMicrobiological testing/measurementDNA/RNA fragmentationRetrotransposon transpositionTriticeae
The present invention discloses an agropyron cristatum centromere specific Gypsy retrotransposon sequence and application thereof, and an agropyron cristatum centromere specific Gypsy retrotransposon is (a) or (b): (a) is a DNA molecule shown as 37th-803th site nucleotides from 5 'end of a sequence 1, or (b) is a DNA molecule shown as the sequence 1. The present invention also provides a specific primer pair comprising a single-stranded DNA molecule shown as a sequence 2 of a sequence table and a single-stranded DNA molecule shown as a sequence 3 of the sequence table. Significances are as follows: (1) acquisition of centromeric retrotransposon pAcCR1 has an important role for the study of agropyron plant evolution; (2) due to acquisition of a large number of wheat-agropyron cristatum translocation lines, new challenges for rapid detection of exogenous chromatin in agropyron cristatum are put forward, and P chromatin of a centromeric region of the agropyron cristatum under wheat background can be efficiently detected on the basis of acquisition of a retrotransposon specific molecular marker of a P genome centromeric region.
Owner:INST OF CROP SCI CHINESE ACAD OF AGRI SCI

Development of Mammalian Genome Modification Technique Using Retrotransposon

To comprehensively modify genome, it is intended to develop a transposition system of the copy and paste type which has an improved efficiency. This object has been achieved by the finding that an LTR retrotransposon is partly usable in a transposition system. Namely, a technique of efficiently transferring a foreign gene into a cell by using a transposon. More specifically speaking, a complete IPA element and a functional promoter sequence are found out. It is clarified that, without a combination of them, a retrotransposon cannot exert its function.
Owner:OSAKA INDAL PROMOTION ORG +1

Method for batch inspection of plant genome LTR-retrotransposon

The invention discloses a method for batch inspection of plant genome LTR-retrotransposon. An LTR_STRUC program based on structural characteristics and searching from the beginning, a CROSS_MATCH program based on homology searching and a CLUSTALW comparison program based on sequence similarity are comprehensively applied in the method for the batch inspection of the plant genome LTR-retrotransposon, and Perl scripting language programming and other methods are combined. Experimental results show that the method for the batch inspection of the plant genome LTR-retrotransposon is relatively systematic, the effect for detecting the direct repeat of the inserting sites of the plant genome LTR-retrotransposon is good, speed is high, and process operation is easy to achieve. According to the method, the frequently-used software for detecting the plant genome LTR-retrotransposon and the Perl scripting language programming are combined, and certain defects of the frequently-used software are made up. The method can play an important role in genome annotation and the batch inspection of the plant genome LTR-retrotransposon.
Owner:JIANGSU ACAD OF AGRI SCI

Or gene and its use in manipulating carotenoid content and composition in plants and other organisms

InactiveUS8071841B2Increase carotenoid contentSugar derivativesOther foreign material introduction processesBeta-CaroteneHigh level expression
The cauliflower (Brassica oleracea L. var. botrytis) Or gene is a semi-dominant, single-locus mutation. It induces the accumulation of high levels of beta-carotene in various tissues that are normally devoid of carotenoids, turning them orange. Using a map-based cloning strategy, we identified a single gene representing Or and successfully verified its identity by functional complementation in the wild type cauliflower. The Or gene encodes a plastid membrane protein containing the DnaJ zinc figure domain. A likely gain-of-function mutation from a 4.3-kb retrotransposon insertion in the Or allele confers the orange phenotype in the mutant. Southern blot analysis revealed that Or is a single-copy sequence in the cauliflower genome. High level of expression of the Or gene and the protein was found in very young leaves, curds, and flowers at comparable abundance between wild type and the Or mutant. Or likely functions in regulating the differentiation of some non-photosynthetic plastids into chromoplasts, which provide the deposition “sink” for carotenoid accumulation. Successful demonstration of Or in conferring carotenoid accumulation in potato tubers indicates its potential use to improve the nutritional value in staple crops.
Owner:US SEC AGRI

Saccharum spontaneum retrotransposon sequence and identification method thereof

ActiveCN110184267AStrong specificityFacilitate identification researchMicrobiological testing/measurementDNA/RNA fragmentationAgricultural scienceMetaphase chromosome
The invention discloses a saccharum spontaneum retrotransposon sequence and an identification method of the saccharum spontaneum retrotransposon sequence. Four saccharum spontaneum retrotransposon sequences are screened out using cluster analysis of genome data of saccharum spontaneum and a tropical species; primers are designed separately according to the sequences for amplification to form a full-length sequence; then, a probe is prepared; fluorescence in situ hybridization (FISH) identification is performed on metaphase chromosomes of the saccharum spontaneum and the tropical species; and aresult shows that the four retrotransposon sequences generate clear and bright signals on the saccharum spontaneum chromosomes. The retrotransposon sequence can be directly used for specific identification of the saccharum spontaneum chromosomes, provides more accurate information for blood relationship identification of the saccharum spontaneum in cultivated sugarcane varieties, and lays a foundation for chromosome engineering breeding of sugarcane.
Owner:FUJIAN AGRI & FORESTRY UNIV

Pig genome molecular marker excavation method based on combination of LINE1 transposon and microsatellite primer

The invention relates to a pig genome molecular marker excavation method based on combination of LINE1 transposon and a microsatellite primer. The method uses a 5'-terminal nucleotide sequence or a 3'-terminal nucleotide sequence of LINE1 to design a specific primer; according to bioinformatic analysis, the microsatellite sequences widely distributed in the pig genome are obtained to design the microsatellite primer; two primers are combined, and the different types of the pig genomes can be taken as a template for amplification; an amplification strip having clearness, high polymorphism and good repeatability is screened, and clone sequencing is carried out; a sequencing result is subjected to comparative analysis, combination of a side specific primer and a retrotransposon LINE1 specificprimer can be designed, a to-be-verified molecule-labeled primer is used for PCR amplification of different types of individual genome samples, the primer combination capable of clearly amplifying the strip and having polymorphism can be selected, and the molecular marker can be obtained. The method can provides the useful molecular marker for marker auxiliary selection in pig lines identification and breeding.
Owner:YANGZHOU UNIV

Method for disrupting genes using tobacco retrotransposon

The present invention relates to a method for disrupting a gene in a plant using a tobacco retrotransposon, comprising the steps of introducing the retrotransposon into the plant, and culturing and regenerating the plant, into which the retrotransposon is introduced, to produce a transformed plant.
Owner:NAT INST OF AGROBIOLOGICAL SCI

Retrotransposon promoter PCb-RARE induced by high salt and salicylic acid and application of retrotransposon promoter PCb-RARE

The invention discloses a retrotransposon promoter PCb-RARE induced by high salt and salicylic acid and application of the retrotransposon promoter PCb-RARE. The promoter is derived from an LTR region of Carallia brachiata retrotransposon Cb-RARE-1, and is shown as SEQ ID NO: 1. A recombinant expression vector which contains the promoter and GUS gene is converted into Arabidopsis, the promoter is proved to be inducted of NaCl and the salicylic acid, and the promoter can be used for screening of saline-alkali tolerant plants and molecular breeding by using the characteristic. The inducible promoter is used for inducing foreign gene to be expressed in a plant, and the promoter function can be activated or suppressed by stimulation of the high salt or the salicylic acid, so that gene expression can be activated or suppressed by using high-concentration sodium chloride or salicylic acid in specific time or in a growth stage, synthesis of gene products can be controlled, and the growth of the plant can be adjusted on purposes.
Owner:SUN YAT SEN UNIV +1

P genome specific Gypsy retrotransposon and application thereof

The invention discloses a P genome specific Gypsy retrotransposon and application thereof. P genome specific Gypsy retrotransposon provided by the invention is as shown in either (a) or (b), wherein (a) refers to a DNA molecule shown as nucleotides on the 531st-1575th sites from 5' end of a sequence 1; and (b) refers to a DNA molecule as shown in the sequence 1. The invention also protects a specific primer pair composed of a single-stranded DNA molecule as shown in a sequence 2 in a sequence list and a single-stranded DNA molecule as shown in a sequence 3 in the sequence list. The Gypsy retrotransposon and the application thereof disclosed by the invention have the following significances: (1) the acquisition of an interspersed repetitive sequence pAcPR1 is important for researching the evolution of agropyron plants; and (2) the acquisition of a great amount of wheat-agropyron translocation lines brings a new challenge for the rapid detection of exogenous agropyron chromatins; and the acquisition of a specific molecular marker based on the P genome retrotransposon is conductive to the efficient detection of the agropyron chromatins on the background of wheat.
Owner:INST OF CROP SCI CHINESE ACAD OF AGRI SCI

REMAP marker for evaluating genetic diversity of cyprinus carpio population

The invention discloses a cyprinus carpio retrotransposon marker. A high-polymorphism retrotransposon REMAP marker of cyprinus carpio is developed by predicting and identifying a cyprinus carpio retrotransposon sequence, screening a cyprinus carpio polymorphism REMAP marker and performing genetic polymorphism detection on a cyprinus carpio retrotransposon locus. The cyprinus carpio retrotransposon marker disclosed by the invention can be applied to the research on the population genetic structure, genetic variation level and the like of the cyprinus carpio population and the germplasm identification of the geographical population of cyprinus carpio.
Owner:CHINESE ACAD OF FISHERY SCI

Method for genetic detection using interspersed genetic elements: multiplexed DNA analysis system

ActiveCN104822845ASugar derivativesMicrobiological testing/measurementPaternity analysisForensic science
By utilizing a Mini-Primer strategy targeting the target site duplication (TSD) sequence of retrotransposons, INNUL markers, which include SINEs, LINEs, and SVAs, can be effectively used as markers for human identification and bio-ancestry studies regardless of the size of the inserted element. The size of the amplicons for INNULs and the difference between allelic states can be reduced substantially such that these markers have utility for analyzing high and low quality human DNA samples. A 15 RE marker and Amelogenin (for sex determination) multiplex for a single tube amplification of DNA, in four color detection was successfully designed. The multiplex provided power of discrimination suitable for forensic and paternity analysis. In addition, sensitivity of detection can enable human identity and bio-ancestry studies on forensic and anthropological samples. Depending on the distribution of the alleles in global populations, INNULs can be selected for human identity testing or for bio-ancestry studies.
Owner:素德赫·辛哈

Method for genetic detection using interspersed genetic elements: a multiplexed DNA analysis system

By utilizing a Mini-Primer strategy targeting the target site duplication (TSD) sequence of retrotransposons, INNUL markers, which include SINEs, LINEs, and SVAs, can be effectively used as markers for human identification and bio-ancestry studies regardless of the size of the inserted element. The size of the amplicons for INNULs and the difference between allelic states can be reduced substantially such that these markers have utility for analyzing high and low quality human DNA samples. A 15 RE marker and Amelogenin (for sex determination) multiplex for a single tube amplification of DNA, in four color detection was successfully designed. The multiplex provided power of discrimination suitable for forensic and paternity analysis. In addition, sensitivity of detection can enable human identity and bio-ancestry studies on forensic and anthropological samples. Depending on the distribution of the alleles in global populations, INNULs can be selected for human identity testing or for bio-ancestry studies.
Owner:LIFE GENETICS LAB

Method of utilizing Tnt1 retrotransposon with controllable inducible expression and re-transposition loss to establish plant mutant library

InactiveCN108220331ASolve the problem of screening resistance with library constructionSolve the problem of screening resistanceVector-based foreign material introductionPlant genotype modificationAgricultural scienceNicotiana tabacum
The invention discloses a method of utilizing a Tnt1 retrotransposon, which is established based on controllable inducible expression and does not have any re-transposition performance after one-timetransposition to establish a plant mutant library. The method is characterized in that the sequence before TATA (four bases) of the AAGCTTTGGCTATAAAAGGAGAGC sequence of the first repeat area of the tobacco Tnt1 retrotransposon sequence is eliminated, and the modified sequence is fused with the TATA sequence of an inducible expression promoter; and the TATA (four bases) of the AAGCTTTGGCTATAAAAGGAGAGC sequence of the second repeat area of the tobacco Tnt1 retrotransposon sequence are mutated to remove the functions. The invention aims to provide a method, which can rapidly establish a reliablemutant library through simple manual control and only using sexual reproduction; and the method can satisfy the requirements of genetic research of crops and crop breeding and can be applied to scientific research on crops.
Owner:NORTHWEST A & F UNIV

Method for genetic detection using interspersed genetic elements: a multiplexed DNA analysis system

By utilizing a Mini-Primer strategy targeting the target site duplication (TSD) sequence of retrotransposons, INNUL markers, which include SINEs, LINEs, and SVAs, can be effectively used as markers for human identification and bio-ancestry studies regardless of the size of the inserted element. The size of the amplicons for INNULs and the difference between allelic states can be reduced substantially such that these markers have utility for analyzing high and low quality human DNA samples. A 15 RE marker and Amelogenin (for sex determination) multiplex for a single tube amplification of DNA, in four color detection was successfully designed. The multiplex provided power of discrimination suitable for forensic and paternity analysis. In addition, sensitivity of detection can enable human identity and bio-ancestry studies on forensic and anthropological samples. Depending on the distribution of the alleles in global populations, INNULs can be selected for human identity testing or for bio-ancestry studies.
Owner:LIFE GENETICS LAB

Construction methods and uses of Jian carp retrotransposon and transgenic vector

InactiveCN105567711AGood homologyHigh transposition efficiencyTransferasesNucleic acid vectorGene transferNucleotide sequencing
The invention discloses construction methods and uses of a Jian carp retrotransposon and a transgenic vector. The transposon includes a nucleotide sequence represented by SEQ ID NO.1; an artificially designed and synthesized nucleotide sequence is represented by SEQ ID NO.2; and the above gene vector includes the Jian carp retrotransposon and / or the artificially designed and synthesized nucleotide sequence represented by the SEQ ID NO.2. The Jian carp retrotransposon and the gene vector can be applied in introduction of mediated DNA to cells. Transposable activity verification in Jian carp hepatocytes confirms that the transposon has transposable activity, and efficient transposon of a gene transfer system in the Jian carp hepatocytes is realized, so foundation is laid for further verification of the transposon efficiency of the transposon and relevant researches and application of the transposon in vertebrates.
Owner:FRESHWATER FISHERIES RES CENT OF CHINESE ACAD OF FISHERY SCI

Method for quickly distinguishing bud mutation of grape

InactiveCN102965434BQuick Differentiation MethodMicrobiological testing/measurementMaterial resourcesBiology
The invention discloses a method for quickly distinguishing bud mutation of grape. The method comprises the following steps in sequence: extracting DNA (Deoxyribose Nucleic Acid) of parent grape plant and corresponding suspected grate plant with bud mutation; amplifying the DNA by iPBS (inter Primer Binding Site) primers; distinguishing the bud mutation of the amplified products by agarose gel electrophoresis; and if difference is generated between the electrophoretic bands of the parent and the suspected variety with bud mutation, determining that the suspected variety with bud mutation is subjected to bud mutation. According to the method, three groups of precocious grape varieties with bud mutation are adopted as the raw materials, and the grape varieties are effectively distinguished by iPBS molecular markers; and by adopting the method, relative sequences of retrotransposon do not need to be predicted, so that high generality is ensured, and the theoretical basis is provided for effective selection mutation. The method is simple and convenient to operate and wide in application, saves much manpower and material resources, and is convenient to popularize.
Owner:HENAN UNIV OF SCI & TECH

Application of DNA target sequence of schistosoma japonicum retrotransposon in schistosomiasis diagnosis

ActiveCN102010861BElucidating genetic differencesGood amplification effectMicrobiological testing/measurementEnzymesSchistosoma speciesNucleotide
Disclosed are retrotransposons of Schistosoma japonicum and uses thereof. Specifically, provided is a retrotransposon having any one of nucleotide sequences selected from sequences showed by SEQ ID NOs:1-25. The retrotransposon may act as marker for blood fluke detection. Also disclosed are primers / primer pairs which specifically amplify said retrotransposon sequences.
Owner:CHINESE NAT HUMAN GENOME CENT AT SHANGHAI +1

A copia retrotransposon specific to the centromere region of p genome and its application

The present invention discloses a P genome acrocentric region specific Copia retrotransposon and applications thereof, wherein the P genome acrocentric region specific Copia retrotransposon is the following (a) or (b): (a) a DNA molecule represented by the nucleotides site 250-883 from the 5' terminal in the sequence 1, and (b) a DNA molecule represented by the sequence 1. The invention further discloses a specific primer pair comprising a single-stranded DNA molecule represented by the sequence 2 in the sequence list and the single-stranded DNA molecule represented by the sequence 3 in the sequence list. According to the present invention, the obtaining of the dispersed repetitive sequence pAcpCR1 provides the important effect for the research of the Agropyron cristatum plant evolution; a lot of wheat-Agropyron cristatum translocation lines are obtained, such that the new challenge is provided for the rapid detection of the exogenous Agropyron cristatum chromatin; and with the obtaining of the retrotransposon specific molecular marker based on the P genome acrocentric region, the efficient detection of the Agropyron cristatum acrocentric region P chromatin under the wheat background can be performed.
Owner:INST OF CROP SCI CHINESE ACAD OF AGRI SCI