Construction methods and uses of Jian carp retrotransposon and transgenic vector
A technology of retrotransposon and gene carrier, applied in the field of genetic engineering, to achieve the effect of high transposition efficiency and good homology
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] Example 1. Acquisition and analysis of Jianli ty3-gypsy retrotransposon JRE
[0025] 1.1 Experimental fish
[0026] Jianli was preserved in our laboratory, and blood was collected for genomic DNA extraction.
[0027] 1.2 Genomic DNA extraction
[0028] Jian carp genomic DNA was extracted using the WholeBloodGenomicDNAExtraction Kit of Dalian Bao Bioengineering Co., Ltd., and the main steps were as follows: 5 Jian carps were taken, and blood was collected from the tail vein aseptically. % ethanol for column purification, and finally use elutionbuffer to elute the DNA bound to the membrane, and use agarose gel electrophoresis for inspection. DNA samples were diluted with distilled water for later use, and other samples were stored at -70°C for later use.
[0029] 1.3 PCR amplification and detection
[0030] According to the partial sequencing results of the Jian carp genome in the previous study and the relevant literature on the conserved region of the Ty3-gypsy tran...
Embodiment 2
[0037] Example 2 Construction of Retrotransposon Transposition Vector
[0038] 1 Experimental method
[0039] Primer design, synthesis, and gene sequencing: According to the principle of In-Fusion technology, when designing cloning primers, 15 bases at both ends of the linearized p-GCFU were introduced to the outside of the upstream and downstream primers for the Survivin gene sequence, so that the cloned The 15 bases outside the primers were homologous to the 15 bases at both ends of the linearized vector, and the downstream primers removed the three bases of the stop codon. Synthesize a pair of primers 5'ACCGGACATATGCCCGGGGATACATCGCCCATCCCTACG3', 5'CCTGCAGGAATTCCCGGGGATACATCGCCCATCCCTACG3'. The primers for PCR identification were designed according to Survivin and the vector, in which the upstream primer was located in Survivin, and the downstream primer was located in the vector, and the downstream primer was also used for the sequencing identification of subsequent positi...
Embodiment 3
[0049] Example 3 Application of Retrotransposon Transposition Vector
[0050] 1 Experimental method
[0051] Select green fluorescent protein (GFP) as the reporter gene, design a pair of primers, both ends of the primers contain AflII and NaeI restriction sites, use PCR to amplify the GFP reporter gene, the pcr reaction program is: 94°C for 30s, 60°C for 5min, 72 ℃ 45s, a total of 30 cycles, the PCR product was detected by 1% agarose gel electrophoresis, the target fragment was recovered, connected to the pMT18T vector (Takara), and verified by sequencing (Zhongmei Taihe Company). The PCR product and expression vector obtained by sequencing were digested and recovered by 1% agarose gel electrophoresis. Then, T4 DNA enzyme was used to ligate and connect to the JRE transposon carrier, and the ligation product was still cloned and amplified by IN-FUSION technology. The screened positive plasmids were sent to Shanghai Boshang Company for sequencing, and the sequencing results sh...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com