Check patentability & draft patents in minutes with Patsnap Eureka AI!

Construction methods and uses of Jian carp retrotransposon and transgenic vector

A technology of retrotransposon and gene carrier, applied in the field of genetic engineering, to achieve the effect of high transposition efficiency and good homology

Inactive Publication Date: 2016-05-11
FRESHWATER FISHERIES RES CENT OF CHINESE ACAD OF FISHERY SCI
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in the face of problems such as the stability and safety of transgenes, only by further in-depth research on the transposon system and transposition mechanism and the influence of host factors on its transformation efficiency in the future can the development of transgenic technology be better promoted

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction methods and uses of Jian carp retrotransposon and transgenic vector
  • Construction methods and uses of Jian carp retrotransposon and transgenic vector
  • Construction methods and uses of Jian carp retrotransposon and transgenic vector

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Example 1. Acquisition and analysis of Jianli ty3-gypsy retrotransposon JRE

[0025] 1.1 Experimental fish

[0026] Jianli was preserved in our laboratory, and blood was collected for genomic DNA extraction.

[0027] 1.2 Genomic DNA extraction

[0028] Jian carp genomic DNA was extracted using the WholeBloodGenomicDNAExtraction Kit of Dalian Bao Bioengineering Co., Ltd., and the main steps were as follows: 5 Jian carps were taken, and blood was collected from the tail vein aseptically. % ethanol for column purification, and finally use elutionbuffer to elute the DNA bound to the membrane, and use agarose gel electrophoresis for inspection. DNA samples were diluted with distilled water for later use, and other samples were stored at -70°C for later use.

[0029] 1.3 PCR amplification and detection

[0030] According to the partial sequencing results of the Jian carp genome in the previous study and the relevant literature on the conserved region of the Ty3-gypsy tran...

Embodiment 2

[0037] Example 2 Construction of Retrotransposon Transposition Vector

[0038] 1 Experimental method

[0039] Primer design, synthesis, and gene sequencing: According to the principle of In-Fusion technology, when designing cloning primers, 15 bases at both ends of the linearized p-GCFU were introduced to the outside of the upstream and downstream primers for the Survivin gene sequence, so that the cloned The 15 bases outside the primers were homologous to the 15 bases at both ends of the linearized vector, and the downstream primers removed the three bases of the stop codon. Synthesize a pair of primers 5'ACCGGACATATGCCCGGGGATACATCGCCCATCCCTACG3', 5'CCTGCAGGAATTCCCGGGGATACATCGCCCATCCCTACG3'. The primers for PCR identification were designed according to Survivin and the vector, in which the upstream primer was located in Survivin, and the downstream primer was located in the vector, and the downstream primer was also used for the sequencing identification of subsequent positi...

Embodiment 3

[0049] Example 3 Application of Retrotransposon Transposition Vector

[0050] 1 Experimental method

[0051] Select green fluorescent protein (GFP) as the reporter gene, design a pair of primers, both ends of the primers contain AflII and NaeI restriction sites, use PCR to amplify the GFP reporter gene, the pcr reaction program is: 94°C for 30s, 60°C for 5min, 72 ℃ 45s, a total of 30 cycles, the PCR product was detected by 1% agarose gel electrophoresis, the target fragment was recovered, connected to the pMT18T vector (Takara), and verified by sequencing (Zhongmei Taihe Company). The PCR product and expression vector obtained by sequencing were digested and recovered by 1% agarose gel electrophoresis. Then, T4 DNA enzyme was used to ligate and connect to the JRE transposon carrier, and the ligation product was still cloned and amplified by IN-FUSION technology. The screened positive plasmids were sent to Shanghai Boshang Company for sequencing, and the sequencing results sh...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses construction methods and uses of a Jian carp retrotransposon and a transgenic vector. The transposon includes a nucleotide sequence represented by SEQ ID NO.1; an artificially designed and synthesized nucleotide sequence is represented by SEQ ID NO.2; and the above gene vector includes the Jian carp retrotransposon and / or the artificially designed and synthesized nucleotide sequence represented by the SEQ ID NO.2. The Jian carp retrotransposon and the gene vector can be applied in introduction of mediated DNA to cells. Transposable activity verification in Jian carp hepatocytes confirms that the transposon has transposable activity, and efficient transposon of a gene transfer system in the Jian carp hepatocytes is realized, so foundation is laid for further verification of the transposon efficiency of the transposon and relevant researches and application of the transposon in vertebrates.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to a Jian carp ty3-gypsy retrotransposon JRE and its application. Background technique [0002] DNA transposons (transposons) are a class of functional DNA fragments that can continuously move positions on eukaryotic chromosomes. one of the reasons. Transposons have been widely used as insertional mutagens or molecular tags for the isolation and cloning of genes, and some can even be used as transformation vectors for the preparation of transgenic animals and plants. piggyBac transposon in Drosophila (Bactroceratryoni, ) [4] , silkworm (Bombyxmori) and other insects, it can be used as an efficient and robust carrier for transgenic research and promote germline transformation. It has also been reported in poultry that the use of mariner transposable elements can achieve the preparation of transgenic chickens. The Tc3 transposable element found in Caenorhabditis legans has been ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/54C12N15/85
CPCC12N9/1276C12N15/85C12N2800/106C12Y207/07049
Inventor 丁炜东邴旭文曹丽萍曹哲明
Owner FRESHWATER FISHERIES RES CENT OF CHINESE ACAD OF FISHERY SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More