Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Construction method and use of a Jian carp retrotransposon and transgene vector

A technology of retrotransposon and gene carrier, which is applied in the field of genetic engineering to achieve the effect of good homology and high transposition efficiency

Inactive Publication Date: 2018-09-28
FRESHWATER FISHERIES RES CENT OF CHINESE ACAD OF FISHERY SCI
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in the face of problems such as the stability and safety of transgenes, only by further in-depth research on the transposon system and transposition mechanism and the influence of host factors on its transformation efficiency in the future can the development of transgenic technology be better promoted

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method and use of a Jian carp retrotransposon and transgene vector
  • Construction method and use of a Jian carp retrotransposon and transgene vector
  • Construction method and use of a Jian carp retrotransposon and transgene vector

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Example 1. Acquisition and analysis of Jianli ty3-gypsy retrotransposon JRE

[0025] 1.1 Experimental fish

[0026] Jian carp were preserved in our laboratory, and blood was collected for genomic DNA extraction.

[0027] 1.2 Genomic DNA extraction

[0028] Jian carp genomic DNA was extracted using the Whole Blood Genomic DNA Extraction Kit of Dalian Bao Bioengineering Co., Ltd., and the main steps were as follows: 5 Jian carps were taken, and blood was collected from the tail vein aseptically. After digestion at ℃ for 15 min, 200 µL of 100% ethanol was added for column purification, and finally the DNA bound to the membrane was eluted with elution buffer, and checked by agarose gel electrophoresis. DNA samples were diluted with distilled water for later use, and other samples were stored at –70°C for later use.

[0029] 1.3 PCR amplification and detection

[0030]According to the partial sequencing results of the Jian carp genome in the previous study and the releva...

Embodiment 2

[0037] Example 2 Construction of Retrotransposon Transposition Vector

[0038] 1 Experimental method

[0039] Primer design, synthesis, and gene sequencing: According to the principle of In-Fusion technology, when designing cloning primers, 15 bases at both ends of the linearized p-GCFU were introduced on the outside of the upstream and downstream primers targeting the Survivin gene sequence, so that the cloning The 15 bases outside the primers are homologous to the 15 bases at both ends of the linearized vector, and the downstream primers remove the three bases of the stop codon. Synthesize a pair of primers 5'ACCGGACATATGCCCGGGGATACATCGCCCATCCCTACG3', 5'CCTGCAGGAATTCCCGGGGATACATCGCCCATCCC T ACG3'. The primers for PCR identification were designed according to Survivin and the vector, in which the upstream primer was located in Survivin, the downstream primer was located in the vector, and the downstream primer was also used for subsequent sequencing identification of positiv...

Embodiment 3

[0049] Example 3 Application of Retrotransposon Transposition Vector

[0050] 1 Experimental method

[0051] Select green fluorescent protein (GFP) as the reporter gene, design a pair of primers, both ends of the primers contain AflII and NaeI restriction sites, use PCR to amplify the GFP reporter gene, the pcr reaction program is: 94 ℃ 30s, 60 ℃ 5min, 72 ℃ 45s, a total of 30 cycles, the PCR product was detected by 1% agarose gel electrophoresis, the target fragment was recovered, connected to the pMT18T vector (Takara), and verified by sequencing (Zhongmei Taihe Company). The PCR product and expression vector obtained by sequencing were digested and recovered by 1% agarose gel electrophoresis. Then use T4 DNase to ligate and connect to the JRE transposon carrier, and the ligation product is still cloned and amplified by IN-FUSION technology. The screened positive plasmids were sent to Shanghai Boshang Company for sequencing, and the sequencing results showed that the GFP ge...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses construction methods and uses of a Jian carp retrotransposon and a transgenic vector. The transposon includes a nucleotide sequence represented by SEQ ID NO.1; an artificially designed and synthesized nucleotide sequence is represented by SEQ ID NO.2; and the above gene vector includes the Jian carp retrotransposon and / or the artificially designed and synthesized nucleotide sequence represented by the SEQ ID NO.2. The Jian carp retrotransposon and the gene vector can be applied in introduction of mediated DNA to cells. Transposable activity verification in Jian carp hepatocytes confirms that the transposon has transposable activity, and efficient transposon of a gene transfer system in the Jian carp hepatocytes is realized, so foundation is laid for further verification of the transposon efficiency of the transposon and relevant researches and application of the transposon in vertebrates.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to a Jian carp ty3-gypsy retrotransposon JRE and its application. Background technique [0002] DNA transposons (transposons) are a class of functional DNA fragments that can continuously move positions on eukaryotic chromosomes. They play an important role in the discovery of new genes and the analysis of gene functions, and are considered to be the main cause of genetic variation in eukaryotic organisms. one of the reasons. Transposons, as insertional mutagens or molecular tags, have been widely used in the isolation and cloning of genes, and some can even be used as transformation vectors for the preparation of transgenic animals and plants. piggyBac Transposons in Drosophila ( Bactrocera tryoni ,) [4] , silkworm ( Bombyx mori ) and other insects, it can be used as an efficient and robust carrier for transgenic research and promote germline transformation. Poultry has al...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/54C12N15/85
CPCC12N9/1276C12N15/85C12N2800/106C12Y207/07049
Inventor 丁炜东邴旭文曹丽萍曹哲明
Owner FRESHWATER FISHERIES RES CENT OF CHINESE ACAD OF FISHERY SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products