Monooxygenase mutant and preparation method and application thereof

A monooxygenase and monooxygenase conversion rate technology, applied in the field of genetic engineering, can solve the problems of large amount of enzyme added, low enzyme stability, poor soluble expression, etc. Effect

Active Publication Date: 2018-07-20
ASYMCHEM LAB TIANJIN
View PDF4 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

CN105695425A discloses that CHMOs have great applications in the synthesis of chiral drugs, can catalyze the oxidation of sulfur-containing chiral precursors, and are used in the synthesis of chiral drugs modafinil and omeprazole, but existing CHMOs have low enzyme activity, poor stability, poor soluble expression, low selectivity, large amount of enzyme added, and difficult post-processing
[0006] Although several CHMOs have been commercialized, CHMOs generally have problems such as poor soluble expression, low enzyme activity, low enzyme stability, and low selectivity.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Monooxygenase mutant and preparation method and application thereof
  • Monooxygenase mutant and preparation method and application thereof
  • Monooxygenase mutant and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0054] Example 1 Monooxygenase mutant of single point mutation (M25A)

[0055] Construction of monooxygenase mutant genes:

[0056] In order to improve the activity, stability and soluble expression of monooxygenase CHMO (its amino acid sequence is SEQ ID NO.1, and its encoding nucleotide sequence is SEQ ID NO.2) derived from Brachymonas petroleovorans, select properties, reduce the amount of enzyme used, and mutate the M25A site respectively. The specific steps are as follows:

[0057] The nucleotide sequence shown in the SEQ ID NO.2 is as follows:

[0058] ATGAGTAGCAGCCCGAGCAGCGCCATCCACTTTGACGCCATTGTGGTGGGTGCCGGTTTTGGCGGCATGTATATGCTGCACAAGCTGCGCGACCAGCTGGGCCTGAAAGTTAAAGTGTTCGACACCGCCGGTGGTATTGGTGGTACCTGGTACTGGAACCGCTATCCGGGTGCCCTGAGCGACACCCATAGCCACGTGTACCAGTACAGCTTCGATGAGGCCATGCTGCAGGAGTGGACATGGAAAAATAAATATCTGACCCAGCCGGAAATCCTGGCATATCTGGAATACGTGGCCGATCGTCTGGATTTACGCCCTGACATTCAGCTGAACACCACCGTTACCAGCATGCATTTTAACGAGGTGCACAATATCTGGGAAGTTCGCACCGATCGTGGCGGCTACTATACAGCACGCTTCATTGT...

Embodiment 2

[0069] Example 2 Monooxygenase Mutants of Single Point Mutation (P106R)

[0070] Perform site-directed mutation on P106R, the specific steps are as follows:

[0071] Introducing mutations: designing forward and reverse primers containing the P106R site, the forward and reverse primers are as follows:

[0072] Upstream primer (SEQ ID NO.5): cgtctggatttacgccgtgacattcagctgaac;

[0073] Downstream primer (SEQ ID NO.6): gttcagctgaatgtcacggcgtaaatccagacg;

[0074] Other methods and steps are the same as in Example 1.

Embodiment 3

[0075] Example 3 Monooxygenase Mutants of Single Point Mutation (R159L)

[0076] Introducing mutations: designing forward and reverse primers containing the R159L site, the forward and reverse primers are as follows:

[0077] Upstream primer (SEQ ID NO.7): cgaacatcccgggccttgagtcttttcaagg;

[0078] Downstream primer (SEQ ID NO.8): ccttgaaaagactcaaggcccgggatgttcg;

[0079] Other methods and steps are the same as in Example 1.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of genetic engineering, and particularly relates to a monooxygenase mutant and a preparation method and application thereof. The monooxygenase mutant is provided with any one of amino acid sequences as shown in formulas (I) and (II), wherein the amino acid sequence in the formula (I) reaches 80% consistency with the amino acid sequence as shown in SEQ ID NO.1; the amino acid sequence in formula (II) is obtained by modifying, substituting, decreasing or increasing one or some amino acid to 23 to 508 amino acid sites of the amino acid sequence as shown in SEQ ID NO.1; 1-34 amino acid is substituted; the mutant has the activity of monooxygenase. According to the method, a plurality of different sites, namely, 23-508 amino acid sites, are mutated; and the result shows that the mutants are capable of improving the activity, stability, soluble expression and selectivity of monooxygenase as well as decreasing the dosage of monooxygenase.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a monooxygenase mutant and its preparation method and application. Background technique [0002] Chiral sulfoxides widely exist in nature and are the structural units of many important biologically active molecules, as well as important intermediates in the synthesis of natural products and chiral drugs. Many chiral sulfoxides contain one or more chiral centers. The pharmacological activity, metabolic process, metabolic rate, and toxicity of different chiral drugs are significantly different. Usually, one enantiomer is effective, while the other enantiomer is effective. body is inefficient or ineffective, or even toxic. Therefore, how to efficiently and stereoselectively construct compounds containing chiral centers is of great significance in pharmaceutical research and development. [0003] Baeyer Villiger monooxygenases (BVMOs) belong to flavin monooxygenases, wh...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/02C12N15/53C12P17/12
CPCC12N9/0073C12Y114/13022C12P11/00C12P17/12C12N9/0071
Inventor洪浩詹姆斯·盖吉卢江平焦学成张娜李瑞张克俭张瑜
OwnerASYMCHEM LAB TIANJIN