Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A kind of quality detection method of dendrobium officinale

A quality inspection method and technology of Dendrobium officinale, applied in the directions of biochemical equipment and methods, microbial determination/inspection, measurement devices, etc., can solve problems such as the inability to fully reflect the overall curative effect, and achieve the purpose of interpretation and applicability. The effect of correlation analysis, effective identification and quality control

Active Publication Date: 2021-03-16
北京蓝标一成科技有限公司
View PDF8 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In traditional Chinese medicine under the guidance of traditional Chinese medicine theory, any active ingredient cannot fully reflect the overall curative effect of traditional Chinese medicine.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of quality detection method of dendrobium officinale
  • A kind of quality detection method of dendrobium officinale
  • A kind of quality detection method of dendrobium officinale

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] The generation sequencing of embodiment 1 dendrobium officinale

[0052] First-generation sequencing primer sequences:

[0053] ITS-26SE: 5'GAATTCCCCGGTTCGCTCGCCGTTAC 3';

[0054] ITS-17SE: 5' ACGAATTCATGGTCCGGTGAAGTGTTCG 3'.

[0055] The amplification and sequencing parameters are: denaturation at 98°C for 2 minutes and then PCR cycle, the PCR cycle parameters are 98°C for 20s; 52°C for 30s; 68°C for 1min, 38 cycles, 68°C for 7min, set 4°C after the amplification, and perform Generation Molecular Sequencing.

[0056] Through the first-generation sequencing, the species of Dendrobium to be tested was identified as Dendrobium officinale.

Embodiment 2

[0057] The extraction method of embodiment 2 Dendrobium officinale

[0058] Take the dry sample of Dendrobium officinale, pulverize it with a pulverizer, pass through a pharmacopoeia sieve (aperture 0.335mm), accurately weigh 1.000g of Dendrobium powder (the weighing error cannot exceed 0.2%), place it in a 100ml Erlenmeyer flask, add 50mL of 75% Methanol (V water: V methanol = 25:75), after ultrasonication for 30 minutes at room temperature, it was taken out, filtered, the filtrate was concentrated to dryness by rotary evaporation, dissolved in 75% methanol solvent (V water: V methanol = 25:75), and finally transferred to Dilute to volume in a 10ml volumetric flask, shake well, and filter with a 0.45 μm microporous membrane to obtain a sample solution of Dendrobium officinale.

Embodiment 3

[0059] The chromatographic detection method of the Dendrobium officinale extract of embodiment 3

[0060] ①Preparation of reference solution

[0061] Accurately weigh 4.10 mg of Schaftoside and 4.08 mg of naringenin, place them in 10 ml volumetric flasks, add 75% (V / V) methanol to dissolve and dilute, shake well, and use them as stock solutions. Refrigerate at 4°C for later use.

[0062] Then accurately draw a certain amount of reference substance stock solution and dilute with 75% methanol to accurately prepare a mixed reference substance solution of schaffertoside and naringenin. Through different dilution ratios, 7 concentration points of the prepared components were diluted. into a high performance liquid chromatograph.

[0063] ②Extraction and processing method of samples for determination of small molecule components in Dendrobium officinale:

[0064] Take 1.00g of the powder of this product (passed through a No. 3 sieve), accurately weigh it, put it in a 100ml volum...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a quality detection method of Dendrobium catenatum Lindley. The quality detection method comprises: 1) sequencing by using ITS-26SE and ITS-17SE as primers to identify the variety of a to-be-detected Dendrobium herb; 2) carrying out chromatographic detection on n samples to obtain detection data using a chemical small molecule component schaftoside and / or naringenin as a reference component; 3) respectively carrying out fingerprint detection on the samples to obtain the fingerprint peak area value of the full chemical components of Dendrobium catenatum Lindley; and 4) establishing an analysis model by using the content value of the schaftoside and / or naringenin in the chromatographic data as the response variable and using the peak area value of other components inthe fingerprint as the independent variable, screening the variable through a Lasso method, and establishing the fingerprint model related to the chemical small molecule component. According to the present invention, through the first-generation sequencing and the characteristic fingerprinting, the quality of Dendrobium catenatum Lindley is precisely identified and controlled.

Description

technical field [0001] The invention belongs to the field of detection and analysis of traditional Chinese medicine components, and in particular relates to a quality detection method of dendrobium officinale. Background technique [0002] Dendrobium catenatum Lindley, Dendrobium officinale Kimura&Migo: also known as black knot grass. Stems erect, rarely prostrate or oblique, fleshy, cylindrical, 9cm-35cm long, 0.2cm-0.4cm in diameter, unbranched, multi-noded, internodes 1.3cm-1.7cm long; leaf bases descending into clamshells The sheath, edge and middle rib are often lavender, and the leaf sheath often has purple spots. When it is old, its upper edge is loose from the stem and opens, and leaves a ring-shaped iron-blue gap with the nodes. The racemes often originate from the upper part of the old stems of deciduous leaves, with 2-3 flowers; the peduncle is 0.5cm-1.0cm long, and the base has 2-3 short sheaths; the inflorescence rachis is bent back, 2cm-4cm long; Bracts dry m...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): G01N30/02G01N30/06C12Q1/6895
CPCC12Q1/6895G01N30/02G01N30/06
Inventor 赵田
Owner 北京蓝标一成科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com