Unlock instant, AI-driven research and patent intelligence for your innovation.

Gene chip targeting second generation sequencing and aiming at congenital hypothyroidism

A congenital, hypothyroid technology, applied in the field of biomedicine, can solve problems such as inability to obtain clear results, time-consuming and laborious, limited to one or a few, etc.

Pending Publication Date: 2018-08-17
SHANGHAI NINTH PEOPLES HOSPITAL AFFILIATED TO SHANGHAI JIAO TONG UNIV SCHOOL OF MEDICINE
View PDF6 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] In recent years, there have been more and more literature reports on the research on the causative genes of congenital hypothyroidism. So far, more than 20 gene mutations have been reported that can lead to the occurrence of congenital hypothyroidism. Molecular diagnosis of diseases is often limited to one or a few genes, and the method of Sanger sequencing of candidate genes is time-consuming and laborious, and sometimes no clear results can be obtained

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene chip targeting second generation sequencing and aiming at congenital hypothyroidism
  • Gene chip targeting second generation sequencing and aiming at congenital hypothyroidism
  • Gene chip targeting second generation sequencing and aiming at congenital hypothyroidism

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0155] Screening and Identification of Related Gene Loci of Example 1 CH

[0156] Step (1): Select 21 known pathogenic genes that may cause CH, including PAX8, NKX2-1, FOXE1, NKX2-5, HHEX, GNAS, DUOX2, DUOXA2, DUOX1, DUOXA1, TPO, TG, SLC26A4, SLC5A5, IYD, DIO1, DIO2, TSHR, THRA, THRB, and SLC16A2.

[0157] According to the gene sequence in GRCh37 / hg19 in UCSC Genome Browser, the gene's chromosome position, coding, gene size and pseudogene status were clarified.

[0158] Step (2): According to Access Array TMSystem amplification requirements (the target sequence size is 220bp, there is overlap), design primers, and add tag sequences.

[0159] For example, the primers for detecting chr15:45398270-45398487 (218bp) of DUOX2 are as follows:

[0160] W4-DUOX2-E15-2-S7686-F: ACACTGACGACATGGTTCTACAATCATCATCCAGCTGCTGTC

[0161] (SEQ ID NO.: 1)

[0162] W4-DUOX2-E15-2-S7686-R: TACGGTAGCAGAGACTTGGTCTATAATGGAGTCGTGTGAGGG

[0163] (SEQ ID NO.:2)

[0164] Step (3): After primer synth...

Embodiment 2

[0194] The identification of the pathogenic gene locus of embodiment 2CH

[0195] In this embodiment, the second population sample is detected, and the method is the same as that in Embodiment 1. The sample size of this embodiment is 110 cases of CH patients and 200 cases of normal people.

[0196] result:

[0197] Among the 110 patients with CH, 51 were detected to have biallelic mutations in the three genes of DUOX2, TG or TPO, that is, the pathogenic gene of CH in 51 patients was one of these three genes . However, no biallelic mutations of the above three genes were detected in 200 normal persons.

[0198] Specifically, in terms of single genes, 66 of 110 CH patients (60%, 66 / 110) carried DUOX2 mutations, the mutation incidence of TPO was 10.91% (12 / 110), and the mutation incidence of TG was 16.36 % (18 / 110).

[0199] In addition, 21 cases (19.1%) also detected mutations in DUOXA1 and DUOX1 genes.

Embodiment 3

[0200] Identification of the relevant gene locus of embodiment 3CH

[0201] In this embodiment, the third population sample is detected, and the method is the same as that in Embodiment 1. The number of samples in this embodiment is 200 cases of CH patients and 200 cases of normal people.

[0202] result:

[0203] Of the newly discovered SNVs shown in Table 1, 17 (about 70%) were detected in this third group of CH patients, but not in normal people, which suggested that the SNVs shown in Table 1 The newly discovered SNVs have a certain frequency in CH patients and can be used as targets for auxiliary detection or early diagnosis of CH.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a gene chip targeting second generation sequencing and aiming at congenital hypothyroidism (CH) disease, and particularly provides congenital hypothyroidism related gene or locus thereof and / or application of a detection reagent thereof in preparing reagents or kits. The reagents or the kits are used for (a) detecting risk of a detected object in being attacked by the disease, (b) molecularly diagnosing or molecularly subtyping CH patients and / or (c) evaluating risk of later generations of the detected object in being attacked by CH, and CH pathogenic genes include DUOX2, TG and TPO. The gene chip is suitable for clinically diagnosed peripheral CH patients, especially Chinese CH patients, supportive of high-throughput test and clinical popularization and conducive tomolecular diagnosis, molecular subtyping and prenatal diagnosis of CH and guiding subsequent treatment of the patients and is of important clinical value.

Description

technical field [0001] The invention relates to the field of biomedicine, in particular to gene mutation diagnosis of congenital hypothyroidism targeted next-generation sequencing. Background technique [0002] With the development and popularization of newborn disease screening in my country, more and more newborns are found to be suffering from congenital hypothyroidism (CH). In Western countries, the incidence of congenital hypothyroidism is about 1 / 3000-1 / 4000. In my country, the screening of neonatal congenital hypothyroidism has been carried out since 1981. At present, the national screening coverage has exceeded 60%. Preliminary data show that the incidence of neonatal congenital hypothyroidism is about 1 / 2050. Congenital hypothyroidism is the most common endocrine and metabolic disease in the Department of Pediatric Endocrinology. If it is not treated in time, it will lead to short stature and mental retardation, commonly known as "credenism", which will cause a ser...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6883C12N15/53
CPCC12Q1/6883C12Q2600/118C12Q2600/156
Inventor 宋怀东赵双霞孙凤宋怀伟
Owner SHANGHAI NINTH PEOPLES HOSPITAL AFFILIATED TO SHANGHAI JIAO TONG UNIV SCHOOL OF MEDICINE