Gene chip targeting second generation sequencing and aiming at congenital hypothyroidism
A congenital, hypothyroid technology, applied in the field of biomedicine, can solve problems such as inability to obtain clear results, time-consuming and laborious, limited to one or a few, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0155] Screening and Identification of Related Gene Loci of Example 1 CH
[0156] Step (1): Select 21 known pathogenic genes that may cause CH, including PAX8, NKX2-1, FOXE1, NKX2-5, HHEX, GNAS, DUOX2, DUOXA2, DUOX1, DUOXA1, TPO, TG, SLC26A4, SLC5A5, IYD, DIO1, DIO2, TSHR, THRA, THRB, and SLC16A2.
[0157] According to the gene sequence in GRCh37 / hg19 in UCSC Genome Browser, the gene's chromosome position, coding, gene size and pseudogene status were clarified.
[0158] Step (2): According to Access Array TMSystem amplification requirements (the target sequence size is 220bp, there is overlap), design primers, and add tag sequences.
[0159] For example, the primers for detecting chr15:45398270-45398487 (218bp) of DUOX2 are as follows:
[0160] W4-DUOX2-E15-2-S7686-F: ACACTGACGACATGGTTCTACAATCATCATCCAGCTGCTGTC
[0161] (SEQ ID NO.: 1)
[0162] W4-DUOX2-E15-2-S7686-R: TACGGTAGCAGAGACTTGGTCTATAATGGAGTCGTGTGAGGG
[0163] (SEQ ID NO.:2)
[0164] Step (3): After primer synth...
Embodiment 2
[0194] The identification of the pathogenic gene locus of embodiment 2CH
[0195] In this embodiment, the second population sample is detected, and the method is the same as that in Embodiment 1. The sample size of this embodiment is 110 cases of CH patients and 200 cases of normal people.
[0196] result:
[0197] Among the 110 patients with CH, 51 were detected to have biallelic mutations in the three genes of DUOX2, TG or TPO, that is, the pathogenic gene of CH in 51 patients was one of these three genes . However, no biallelic mutations of the above three genes were detected in 200 normal persons.
[0198] Specifically, in terms of single genes, 66 of 110 CH patients (60%, 66 / 110) carried DUOX2 mutations, the mutation incidence of TPO was 10.91% (12 / 110), and the mutation incidence of TG was 16.36 % (18 / 110).
[0199] In addition, 21 cases (19.1%) also detected mutations in DUOXA1 and DUOX1 genes.
Embodiment 3
[0200] Identification of the relevant gene locus of embodiment 3CH
[0201] In this embodiment, the third population sample is detected, and the method is the same as that in Embodiment 1. The number of samples in this embodiment is 200 cases of CH patients and 200 cases of normal people.
[0202] result:
[0203] Of the newly discovered SNVs shown in Table 1, 17 (about 70%) were detected in this third group of CH patients, but not in normal people, which suggested that the SNVs shown in Table 1 The newly discovered SNVs have a certain frequency in CH patients and can be used as targets for auxiliary detection or early diagnosis of CH.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


