Gene molecular marker related to yak physique, detection method and kit
A technology of molecular markers and detection methods, applied in the field of molecular biology, can solve problems such as low production performance of yaks, failure to improve production performance of yak quality, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0030] The yaks (Bos grunniens) used in this experiment originated from Luqu County, Gansu Province. Three generations of yaks were randomly selected as population samples. 28 animals (average age 50±6.3 months, male and female 13 and 15 respectively), three generations of 42 animals (average age 16±4.4 months, male and female 20 and 22 respectively), a total of 95 samples.
[0031] DNA extraction
[0032] Methods: 10 mL / head of yak blood sample was collected from the jugular vein, anticoagulated with ACD, and stored at -20°C for later use. Genomic DNA was extracted from frozen blood samples by the phenol-chloroform method.
[0033] PCR amplification
[0034] According to the yak (Bos grunniens) MMP3 gene sequence (GenBank No.NW_005392917.1), a partial sequence template is shown in SEQ ID NO.1;
[0035] ccgatgtgggattcctgacgttggtttcttcagcacctttcctggggagcccaagtggaagaaaactcacctcacgtacaggtaatgggtccaaagagatttttacatactatgagattttataaattactattacaggagaaaatagtatctttattattactttttt...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


