A gene molecular marker, detection method and kit related to yak physique
A molecular marker and yak technology, applied in the field of molecular biology, can solve the problems of low yak production performance, failure to improve yak quality and production performance, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0030] The yaks (Bos grunniens) used in this experiment originated from Luqu County, Gansu Province. Three generations of yaks were randomly selected as population samples. 28 animals (average age 50±6.3 months, male and female 13 and 15 respectively), three generations of 42 animals (average age 16±4.4 months, male and female 20 and 22 respectively), a total of 95 samples.
[0031] DNA extraction
[0032] Methods: 10 mL / head of yak blood sample was collected from the jugular vein, anticoagulated with ACD, and stored at -20°C for later use. Genomic DNA was extracted from frozen blood samples by the phenol-chloroform method.
[0033] PCR amplification
[0034] According to the yak (Bos grunniens) MMP3 gene sequence (GenBank No.NW_005392917.1), a partial sequence template is shown in SEQ ID NO.1;
[0035] ccgatgtgggattcctgacgttggtttcttcagcacctttcctggggagcccaagtggaagaaaactcacctcacgtacaggtaatgggtccaaagagatttttacatactatgagattttataaattactattacaggagaaaatagtatctttattattactttttt...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap