Cell strain capable of expressing glucocerebrosidase with high mannose content as well as preparation method and applications of cell strain
A high mannose and glucose technology, applied in biochemical equipment and methods, other methods of inserting foreign genetic materials, cells modified by introducing foreign genetic materials, etc. High, poor enzyme activity and other problems, to achieve good clinical application prospects, increase drug efficacy, improve the effect of binding ability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0034] The technical solution of the present invention will be clearly and completely described below, obviously, the described embodiments are part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by persons of ordinary skill in the art without making creative efforts belong to the protection scope of the present invention.
[0035] A specific embodiment of the present invention comprises the following steps:
[0036] 1) Design sgRNA according to the key sites of the GNT1 gene sequence, complete the synthesis of sgRNA and primers, and complete the synthesis and extraction of sgRNA / Cas9 plasmid. The sgRNA sequence includes the sequences shown in SEQ ID NO:1 and SEQ ID NO:2:
[0037]CACCGTGACAATGGCAAGGAGCAGA (SEQ ID NO: 1);
[0038] AAACTCTGCTCCTTGCCATTGTCAC (SEQ ID NO: 2).
[0039] 2) Transfect the plasmid synthesized in step 1 into a cell pool stably expressing gl...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com