Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Quinic acid production related recombinant strain of colibacillus, construction method and application thereof

A technology of recombinant strains, Escherichia coli, applied in the field of biology

Active Publication Date: 2018-10-12
TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But there are few reports about the method of producing 3-dehydroquinic acid at present

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Quinic acid production related recombinant strain of colibacillus, construction method and application thereof
  • Quinic acid production related recombinant strain of colibacillus, construction method and application thereof
  • Quinic acid production related recombinant strain of colibacillus, construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0147] The construction of embodiment 1 escherichia coli recombinant strain QA05

[0148] With the plasmid pEASY-cat-sacB (as shown in SEQ ID NO:2) containing chloramphenicol resistance gene cat and fructan sucrose transferase gene sacB figure 2 (shown) is a template, and primer 701aroD-cat-sacB-s / aroD-cat-sacB-a is used to amplify the fragment aroD1 of the first step of homologous recombination. The sequence of primer 701 is:

[0149] aroD-cat-sacB-s:ggtcatggggttcggtgcctgacaggctgaccgcgtgcaggtgacggaagatcacttc

[0150] aroD-cat-sacB-a:cccgcaccaatgacgagatcttttacagttacggttttcaatcaaagggaaaactgtcc

[0151] Amplification system: 5×TransStart TM FastPfu Buffer 10 μL, dNTPs (2.5mmol / L each dNTP) 4 μL, DNA template 1 μL (20-50ng), forward primer (10 μmol / L) 2 μL, reverse primer (10 μmol / L) 2 μL, 100% DMSO 1 μL, TransStart TM FastPfu DNA Polymerase (2.5U / μL) 1 μL, deionized water 29 μL, total volume 50 μL.

[0152] The amplification conditions are: pre-denaturation at 94°C for 5...

Embodiment 2

[0172] The construction of embodiment 2 escherichia coli recombinant strain QA07

[0173] With the plasmid pEASY-cat-sacB (as shown in SEQ ID NO:2) containing chloramphenicol resistance gene cat and fructan sucrose transferase gene sacB figure 2 (shown) is a template, and the primer 707acrB-cat-sacB-s / acrB-cat-sacB-a is used to amplify the fragment acrB1 of the first step of homologous recombination. The sequence of primer 707 is:

[0174] acrB-cat-sacB-s:ctgtcagaattgggtatattggggcaggttgtcgtgaaggaattccctagtgacggaagatcacttc

[0175] acrB-cat-sacB-a:agttttccctggtgttggcgcagtattcgcgcaccccggtctagccggggatcaaagggaaaactgtc

[0176] Amplification system: 5×TransStart TM FastPfu Buffer 10 μL, dNTPs (2.5mmol / L each dNTP) 4 μL, DNA template 1 μL (20-50ng), forward primer (10 μmol / L) 2 μL, reverse primer (10 μmol / L) 2 μL, 100% DMSO 1 μL, TransStart TM FastPfu DNA Polymerase (2.5U / μL) 1 μL, deionized water 29 μL, total volume 50 μL.

[0177] The amplification conditions are: pre-dena...

Embodiment 3

[0198] Example 3 Construction of Escherichia coli recombinant strain QA10

[0199] With the plasmid pEASY-cat-sacB (as shown in SEQ ID NO:2) containing chloramphenicol resistance gene cat and fructan sucrose transferase gene sacB figure 2 (shown) is a template, and primer 1001 2-ackA-pta-cat-sacB-s / 2-ackA-pta-cat-sacB-a is used to amplify the fragment ackA-pta1 of the first step of homologous recombination. The sequence of primer 1001 is:

[0200] 2-ackA-pta-cat-sacB-s:ctgacgtttttttagccacgtatcaattataggtacttcctcctggtgtccctgttgatacc

[0201] 2-ackA-pta-cat-sacB-a:ttcagatatccgcagcgcaaagctgcggatgatgacgagaatagatacatcagagcttttacgag

[0202] Amplification system: 5×TransStart TM FastPfu Buffer 10 μL, dNTPs (2.5mmol / L each dNTP) 4 μL, DNA template 1 μL (20-50ng), forward primer (10 μmol / L) 2 μL, reverse primer (10 μmol / L) 2 μL, 100% DMSO 1 μL, TransStart TM FastPfu DNA Polymerase (2.5U / μL) 1 μL, deionized water 29 μL, total volume 50 μL.

[0203] The amplification conditions a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a quinic acid production related recombinant strain of colibacillus, a construction method and application thereof, which comprises the recombinant escherichia coli for production of the 3-dehydroquinic acid and the recombinant escherichia coli for production of the quinic acid, and both can be fermented with glucose inorganic salt medium under aerobic conditions; the cost of the culture medium is reduced, thereby the production cost of 3-dehydroquinic acid and quinic acid is reduced. And the 3-dehydroquinic acid produced by fermentation can produce quinic acid by simplehydrogenation reaction, thus a theoretical basis for the industrial production of quinic acid is provided, and above recombinant strains do not contain plasmids with stable hereditary.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to recombinant Escherichia coli producing quinic acid and its construction method and application, including recombinant Escherichia coli producing 3-dehydroquinic acid and recombinant Escherichia coli producing quinic acid. Background technique [0002] Quinic acid (quinic acid, QA), that is, 1,3,4,5-tetrahydroxycyclohexane 1-carboxylic acid, was first extracted and processed from cinchona bark, also known as cinchona acid. The medicinal effect of quinic acid monomer is not great, but as a pharmaceutical intermediate to synthesize other drugs with special activity, people are paying more and more attention. Caffeoylquinic acid is an important category of quinic acid derivatives. It exists widely in Chinese herbal medicines and has a protective effect on liver damage caused by carbon tetrachloride and macrophages. Using quinic acid as a chiral source can synthesize a variety of Drugs, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12P7/42C12N15/10C12R1/19
CPCC12N9/88C12N15/102C12P7/42C12Y402/0101
Inventor 王钦宏陈五九江小龙彭彦峰张媛媛
Owner TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com