Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A genetically engineered strain of Escherichia coli producing protocatechuic acid and its construction method and application

A technology of protocatechuic acid and Escherichia coli, which is applied in the field of production of protocatechuic acid recombinant Escherichia coli genetic engineering bacteria and its construction, can solve the problems of genetic instability, affecting the industrial application of products and the like

Active Publication Date: 2022-02-22
TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Although the engineering strains of E. coli constructed in the above studies can produce high concentrations of protocatechuic acid, the related engineering strains contain recombinant plasmids that cause genetic instability, and at the same time, aromatic amino acids or PCA extractants need to be added to the medium to promote cell growth. , thus affecting the industrial application of the product

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A genetically engineered strain of Escherichia coli producing protocatechuic acid and its construction method and application
  • A genetically engineered strain of Escherichia coli producing protocatechuic acid and its construction method and application
  • A genetically engineered strain of Escherichia coli producing protocatechuic acid and its construction method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Embodiment 1, the construction of Escherichia coli genetically engineered bacteria WJ004

[0046] The Escherichia coli genetically engineered strain WJ004 was constructed by weakening the expression regulation of the 3-dehydrogenase shikimate dehydrogenase gene (aroE). A two-step homologous recombination method was used to insert a synthetic regulatory element upstream of the start codon of aroE. P1 (as shown in SEQ ID NO: 1), and replace the original start codon ATG with the rare start codon TTG. The specific construction steps are as follows:

[0047] With the plasmid pEASY-cat-sacB ( figure 2 ) as a template, using primers aroE1-up / aroE1-down to amplify the fragment aroE1 of the first step of homologous recombination. The primer sequences are:

[0048] aroE1-up: GATGCCCTGACGGGTGAACTGTTTCGACAGGGGTAACATA G TGACGGAAGATCACTTC

[0049] aroE1-down: CTGTGGGCTATCGGATTACCAAAAACAGCATAGGTTTCCA ATCAAAGGGAAAACTGTCC

[0050] Amplification system: 5×TransStart TM FastPf...

Embodiment 2

[0068] Embodiment 2, the construction of Escherichia coli genetic engineering bacterium WJ006

[0069] Escherichia coli genetically engineered strain WJ006 is obtained on the basis of Escherichia coli WJ004 through the mutation and expression regulation of the 3-deoxy-D-arabinoheptulose-7-phosphate synthase gene (aroF) construction, using two-step homologous recombination Method, replace the original aroF gene (such as SEQ ID NO:6) with the mutant gene aroF* (such as SEQ ID NO:5) that changes the 443rd base C to T, to remove the 3-deoxy - Tyrosine feedback inhibition of D-arabinoheptulose-7-phosphate synthase with insertion of synthesis regulatory element P2 (eg SEQ ID NO: 2) upstream of the start codon. The specific construction steps are as follows:

[0070] Using Escherichia coli DSM 1576 genomic DNA as a template, the aroF gene was amplified using primers aroF-F / aroF-R. The primer sequence is:

[0071] aroF-F: ATGCAAAAAGACGCGCTGAA

[0072] aroF-R: TTAAGCCACGCGAGCCGTCAG...

Embodiment 3

[0110] Embodiment 3, the construction of Escherichia coli genetic engineering bacterium WJ012

[0111] The Escherichia coli genetically engineered strain WJ012 was constructed on the basis of Escherichia coli WJ006 by regulating the expression of the transketolase gene (tktA). It inserted the synthesis regulation upstream of the tktA start codon through two homologous recombination methods. Element P4 (eg SEQ ID NO: 4). The specific construction steps are as follows:

[0112] With the plasmid pEASY-cat-sacB ( figure 2 ) as a template, using primers tktA1-up / tktA1-down to amplify the fragment tktA1 of the first step of homologous recombination. The primer sequences are:

[0113] tktA1-up: GCCCAAAACGCGCTGTCGTCAAGTCGTTAAGGGCGTGCCCTTCATCAT GTGACGGAAGATCACTTC

[0114] tktA1-down: CATGCTCAGCGCACGAATAGCATTGGCAAGCTCTTTACGTGAGGACAT ATCAAAGGGAAAACTGTCC

[0115] The amplification system is the same as in Example 1, and the amplified tktA1 product comprises the cat-sacB box ( ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The method discloses an Escherichia coli genetic engineering bacterium producing protocatechuic acid, a construction method and application thereof. It can produce protocatechuic acid by expressing 3-dehydrogenase shikimate dehydratase (aroZ) in 3-dehydroshikimic acid-producing Escherichia coli. The bacterial strain can use the glucose inorganic salt medium to ferment and produce protocatechuic acid, which reduces the cost of the medium, thereby reducing the production cost of the protocatechuic acid, and the above-mentioned recombinant bacterial strain does not contain a plasmid and has stable heredity.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to recombinant Escherichia coli genetically engineered bacteria for producing protocatechuic acid and its construction method and application. Background technique [0002] Protocatechuate (PCA) has partial effects such as antibacterial, antiasthma, expectorant, and detoxification, and has the effect of astringent and promoting wound healing. It can be used clinically to treat chronic bronchitis, burns, infantile pneumonia, bacillary dysentery, acute pyelonephritis, acute pancreatitis and certain ulcer diseases. It is also used in medicine, organic intermediates, materials and dye synthesis, as well as feed, food, environmental protection and other fields. PCA can be catalyzed by 3-dehydroshikimate dehydratase (3-dehydroshikimate dehydratase, aroZ) derived from Klebsiella pneumococcus (Klebsiellapneumoniae) on 3-dehydroshikimate (DHS) (Figure 1), At the same time, it is al...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/21C12N15/90C12P7/42C12R1/19
Inventor 王钦宏陈五九江小龙宋国田彭彦峰张媛媛
Owner TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com