The application of wingless signaling pathway gene and dsrna related to limb regeneration of Periplaneta americana
A technology for regenerating related genes, American cockroach, applied in the field of genetic engineering, can solve problems such as difficult control, and achieve the effect of avoiding environmental pollution
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0017] Example 1 Screening of Wingless signaling pathway genes related to amputated limb regeneration
[0018] 1) Preparation of RNA-Seq samples
[0019] Perform operations such as selection, amputation, and collection of leg tissues on Periplaneta americana. The specific amputation operation method is as follows: amputate the joint of the hind limb trochanter and leg joint on one side, and keep the complete base joint and trochanter. Femur, tibia and tarsi cut off together ( figure 1 ), the legs on the other side were all reserved for the control experiment. The basis for the amputation treatment method was that the inventors found that the trochanter played a very important role in the regeneration of the amputated limb. When the trochanter was cut off, it could not regenerate a normal Morphology and function of the new leg; samples were collected at various time points (1dpa, 3dpa, 5dpa, 7dpa and 10dpa (day postamputation, dpa)) after amputation ( figure 1 ); then collect...
Embodiment 2
[0021] Example 2 Synthesis and acquisition of gene dsRNA targeting Wingless signaling pathway
[0022] 1) Design of Wg, Arr and Dsh gene dsRNA primers
[0023] Based on the sequences of Wg, Arr and Dsh genes obtained in this study, the dsRNA design website E-RNAi (https: / / www.dkfz.de / signaling / e-rnai3 / ) was used to target the genes Wg, Arr and Dsh The entire open reading frame sequence was copied and pasted into the website, and the optimal dsRNA targeting sequence was obtained by screening the design parameters. Select the best amplification primer sequences generated by the website, and the dsRNA primers targeting the Wg gene are Wg.T7F: TAATACGACTCACTATAGGAGACGGCGTTCATACGC (SEQ ID No.7) and Wg.T7R: TAATACGACTCACTATAGGTCCGGGTTGTAGGGTTTCA (SEQ ID No.8); The dsRNA primers of the Arr gene are respectively Arr.T7F: GGATCCTAATACGACTCACTATAGGAACGGCACTCATACTGGACC (SEQ ID No.9) and Arr.T7R: GGATCCTAATACGACTCACTATAGG TTTGTTGCTGGTCTTTGTCG (SEQ ID No.10); the dsRNA primers targeting t...
experiment example 1d
[0027] Experimental example 1 In vivo injection of dsRNA affects the regeneration of severed limbs of Periplaneta americana
[0028] In order to verify the functions of the screened Wingless signaling pathway and Wg, Arr and Dsh genes in the process of limb regeneration in Periplaneta americana, the method of dsRNA injection into the newly amputated Periplaneta americana was used. The main principle is to use The gene expression interference function of dsRNA is used to verify the function of the gene, and the injection of CK that does not target any gene of Periplaneta americana is used as a negative control for dsRNA treatment. The general process is as follows: first select the newly casted Periplaneta americana larvae (d0), continue to cultivate for one day to adapt to the surrounding environment, then inject it with dsRNA for the first time (d1), and 24 hours later, treat one side of the Periplaneta americana larvae. Perform amputation operation (d2), retain the complete ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



