A method for improving the enzyme activity of l-amino acid deaminase heterologous expression
A technology of heterologous expression and deaminase is applied in the field of improving the enzyme activity of heterologous expression of L-amino acid deaminase, which can solve the problems of low enzyme activity expression, affecting industrial application, and low bacterial volume, etc., so as to improve the enzyme activity. Live, high industrial application value, improved quantitative effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] A method for improving the enzyme activity of heterologous expression of L-amino acid deaminase, the specific operation steps are as follows:
[0034] 1. Construction of recombinant bacteria
[0035] Total gene synthesis from Proteus mirabilis ( Proteus mirabilis ) L-amino acid deaminase (L-amino acid deaminase, LAAD) gene (genbank accession number EU669819.1) LAAD, and connected into the pET28a vector ( NdeI / Hind ), construct the plasmid laad, transform it into E.Coli BL21 (DE3), and construct the recombinant strain PMLAAD;
[0036] Whole gene synthesis is derived from psychrophilic bacteria ( Psychrobacter piscatorii T-3) catalase (Catalase) gene (genbank accession number EU543218) PKTA, and connected into pET28a vector ( NcoI / Xhol ), construct the plasmid pkta, transform it into E.Coli BL21 (DE3), and construct the recombinant strain PKTA;
[0037] Plasmid pkta, amplified by PCR, adding a DNA fragment (aagctttctagaaataattttgtttaactttaagaaggagatatacc) u...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



