Cell line for conditional induced knockout of mouse spermatogonia Tet3 gene and construction method thereof

A spermatogonia, gene knockout technology, applied in the field of genetic engineering, can solve the problem of off-target problems and other problems, and achieve the effect of easy observation, good effect and high repeatability

Active Publication Date: 2018-12-18
FOSHAN UNIVERSITY
View PDF9 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition, the current use of gene editing systems including CRISPR-Cas9 does not solve the off-target problem well, which is an important constraint affecting the application. This patent screens multiple targets and applies conditional induction methods to avoid off-target effects.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cell line for conditional induced knockout of mouse spermatogonia Tet3 gene and construction method thereof
  • Cell line for conditional induced knockout of mouse spermatogonia Tet3 gene and construction method thereof
  • Cell line for conditional induced knockout of mouse spermatogonia Tet3 gene and construction method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] see figure 1 , is the flow chart of the establishment method of conditionally induced mouse spermatogonia Tet3 gene knockout cell line of the present invention, specifically comprises the following steps:

[0030] 1) Screening of spermatogonia stably expressing the eSpCas9 gene

[0031] The packaged lentivirus (Addgene) carrying the eSpCas9 gene was used to infect the spermatogonia cell line, and the final screening obtained a monoclonal cell colony (such as figure 2 A), and finally obtained a large number of seed cells (such as figure 2 B), for later research use.

[0032] 2) Construction of pLVX-EGFP-mU6-Tet3-sgRNA vector

[0033] Referring to the Tet3 gene sequence (NM_183138) in the Ensembl database, according to the webpage sgRNA target prediction tool: http: / / www.broadinstitute.org / rnai / public / analysis-tools / sgrna-design-v1, the predicted target sequence is (GGAGCTCATCCGGCAATTTG) (SEQ ID NO: 1) (eg image 3A, located downstream of the first exon ATG); the p...

Embodiment 2

[0094] Example 2 Screening of Target Sequences

[0095] The inventor designed a lot of target sequences (see Table 8) during the research process. However, many target sequences have been verified by experiments. The target sites have no cleavage activity, or the cleavage activity is very low, and some target sites have off-target effects, while some target sites have no cleavage activity. Although the site has cleavage activity, it also has off-target effects. The target sequence 7 was finally screened. The genome predicts that there is no possibility of off-target. At the same time, the site has high cleavage activity. Only target sequence 7 is the only site in the mouse genome (see Figure 6 ), there is no similar or identical sequence, which indicates that the target is reliable and there is no off-target effect (using ENSEMBL database Blast results). Therefore, the present invention finally selects the target sequence 7 as the guide sequence.

[0096] Table 8 Tet3 target...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Belonging to the technical field of genetic engineering, the invention relates to a SgRNA targeting sequence for knockout of mouse Tet3 gene, a cell line for conditional induced knockout of mouse spermatogonia Tet3 gene, a construction method and application thereof. The gene editing off-target effect is an important aspect that puzzles the application of gene editing technology. The Tet3 gene target screened by the patent is the only sequence-targeted target screened out from the whole mouse genome, no similar sequence exists in the genome, and therefore off-target effect does not exist theoretically. At the same time, an induced knockout method is employed to close Cas9 protein expression and also can effectively prevent off-target, 24h later after adding of Dox, 97% or more of the mousespermatogonia genome can be knocked out, and the cell lines before and after Dox induction can be employed as good experimental group and control group. The cell line and method established by the invention can be widely applied to Tet3 and other genetic functional study.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering. More specifically, the invention relates to a sgRNA guide sequence for knocking out the mouse Tet3 gene, a conditionally induced mouse spermatogonia Tet3 gene knockout cell line and a construction method thereof. Background technique [0002] The Tet family (Tet1, Tet2, and Tet3) demethylates genomic DNA by oxidizing 5-methylcytosine (5-mC) to 5-hydroxymethylcytosine (5-hmC), an epigenetic regulation one of the important ways. Tet family-mediated methylation regulation is involved in many aspects of stem cell self-renewal, differentiation, reprogramming and carcinogenesis, and different Tet family members have been shown to act on specific cell populations. [0003] Studies have shown that Tet1 / 2 is highly expressed in mouse embryonic stem cells (mESCs), and down-regulating the expression of Tet1 / 2 can reduce the expression of pluripotent factors (such as Oct4, etc.) and promote the ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/113C12N15/867C12N5/10
CPCC12N15/113C12N15/86C07K14/47C12N2310/10C12N2510/00C12N2740/15043C12N2310/20
Inventor白银山朱翠刘珊珊冯美莹詹小舒王丙云
OwnerFOSHAN UNIVERSITY