Unlock instant, AI-driven research and patent intelligence for your innovation.

A conditionally induced mouse spermatogonia tet3 gene knockout cell line and its construction method

A mouse cell and gene technology, applied in the field of genetic engineering, can solve the problem of not solving the off-target problem well, and achieve the effect of easy observation, strong operability and high repeatability

Active Publication Date: 2022-05-06
FOSHAN UNIVERSITY
View PDF9 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition, the current use of gene editing systems including CRISPR-Cas9 does not solve the off-target problem well, which is an important constraint affecting the application. This patent screens multiple targets and applies conditional induction methods to avoid off-target effects.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A conditionally induced mouse spermatogonia tet3 gene knockout cell line and its construction method
  • A conditionally induced mouse spermatogonia tet3 gene knockout cell line and its construction method
  • A conditionally induced mouse spermatogonia tet3 gene knockout cell line and its construction method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] see figure 1 , is the flow chart of the establishment method of conditionally induced mouse spermatogonia Tet3 gene knockout cell line of the present invention, specifically comprises the following steps:

[0030] 1) Screening of spermatogonia stably expressing the eSpCas9 gene

[0031] The packaged lentivirus (Addgene) carrying the eSpCas9 gene was used to infect the spermatogonia cell line, and the final screening obtained a monoclonal cell colony (such as figure 2 A), and finally obtained a large number of seed cells (such as figure 2 B), for later research use.

[0032] 2) Construction of pLVX-EGFP-mU6-Tet3-sgRNA vector

[0033] Referring to the Tet3 gene sequence (NM_183138) in the Ensembl database, according to the webpage sgRNA target prediction tool: http: / / www.broadinstitute.org / rnai / public / analysis-tools / sgrna-design-v1, the predicted target sequence is (GGAGCTCATCCGGCAATTTG) (SEQ ID NO: 1) (such as image 3A, located downstream of the first exon ATG); ...

Embodiment 2

[0094] Example 2 Screening of Target Sequences

[0095] The inventor designed a lot of target sequences (see Table 8) during the research process. However, many target sequences have been verified by experiments, and the target sites have no cleavage activity, or the cleavage activity is very low, while some target sites have off-target effects, while some target sites have no cleavage activity. Although the site has cleavage activity, it also has an off-target effect. The target sequence 7 was finally screened. The genome predicts that there is no possibility of off-target. At the same time, the site has high cleavage activity. Only target sequence 7 is the only site in the mouse genome (see Image 6 ), there is no similar or identical sequence, which indicates that the target is reliable and there is no off-target effect (using ENSEMBL database Blast results). Therefore, the present invention finally selects the target sequence 7 as the guide sequence.

[0096] Table 8 Tet3...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of genetic engineering, and relates to a sgRNA guide sequence for knocking out the mouse Tet3 gene, a conditionally induced mouse spermatogonia Tet3 gene knockout cell line and its construction method and application. The off-target effect of gene editing is a problem An important aspect of the application of gene editing technology, the Tet3 gene target screened by this patent is the target of the unique targeting sequence screened out from the entire mouse genome. There are no other similar sequences in the genome, so there is no off-target effect in theory, and at the same time Using the inducible knockout method to close the expression of Cas9 protein in time can also effectively prevent off-target generation. After adding Dox for 24 hours, more than 97% of the mouse spermatogonia genome was knocked out. Before and after Dox induction, it serves as a good test group and control Group, the cell line and method established by the present invention can be widely used in the study of Tet3 and other gene functions.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering. More specifically, the invention relates to a sgRNA guide sequence for knocking out the mouse Tet3 gene, a conditionally induced mouse spermatogonia Tet3 gene knockout cell line and a construction method thereof. Background technique [0002] The Tet family (Tet1, Tet2, and Tet3) demethylates genomic DNA by oxidizing 5-methylcytosine (5-mC) to 5-hydroxymethylcytosine (5-hmC), an epigenetic regulation one of the important ways. Tet family-mediated methylation regulation involves many aspects such as stem cell self-renewal, differentiation, reprogramming and carcinogenesis, and different Tet family members have been shown to act on specific cell populations. [0003] Studies have shown that Tet1 / 2 is highly expressed in mouse embryonic stem cells (mESCs), and down-regulating the expression of Tet1 / 2 can reduce the expression of pluripotent factors (such as Oct4, etc.) and promote the d...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/113C12N15/867C12N5/10
CPCC12N15/113C12N15/86C07K14/47C12N2310/10C12N2510/00C12N2740/15043C12N2310/20
Inventor 白银山朱翠刘珊珊冯美莹詹小舒王丙云
Owner FOSHAN UNIVERSITY