Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of PBLD gene in preparation of medicine for diagnosing renal clear cell carcinoma and predicting prognosis of same

A renal clear cell carcinoma and gene technology, applied in the field of tumor molecular biology, can solve the problems of unreported significance, less than 10% productivity, and no obvious early symptoms of renal cancer. The method is simple and effective, the result is reliable, and the improvement The effect of detection performance

Inactive Publication Date: 2018-12-18
路君
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The early symptoms of kidney cancer are not obvious, and are often ignored by patients. In recent years, follow-up imaging technology and people's attention to their own health, the discovery of kidney cancer mainly depends on physical examination findings. The traditional "kidney cancer triad" (hematuria, Low back pain, abdominal mass) occur in less than 20%, and about 20-30% of patients have already developed distant metastasis when they see a doctor. The 5-year productivity rate of kidney cancer patients without metastasis is 70%, while that of 5-year productivity less than 10%
However, the significance of this abnormal expression of PBLD in renal clear cell carcinoma in clinical prognosis has not been reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of PBLD gene in preparation of medicine for diagnosing renal clear cell carcinoma and predicting prognosis of same
  • Application of PBLD gene in preparation of medicine for diagnosing renal clear cell carcinoma and predicting prognosis of same
  • Application of PBLD gene in preparation of medicine for diagnosing renal clear cell carcinoma and predicting prognosis of same

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0018] 1. qRT-PCR detection of PBLD mRNA expression levels in 50 pairs of ccRCC and corresponding paracancerous kidney tissue samples

[0019] 1.1 Primer design and synthesis

[0020] Design PBLD-specific primers with the following sequences: Forward: 5'- TCGTCTGGCCCTTAGTTCTC -3' Reverse: 5'-TGGTTTACACCAGCGAGTGA -3'.

[0021] Extraction of RNA from tissues

[0022] 1) Label the EP tubes, take out the tissues from the -80°C refrigerator, and add them in sequence, corresponding to the paracancerous tissue and the number, mash the cancerous tissue and the corresponding paracancerous tissue of each specimen separately, add 300 μl Trizo lysate to fully lyse the tissue, and then Add 700μl Trizo lysate and incubate at room temperature for 5min.

[0023] 2) Add 200 ul of chloroform (trichloromethane) to each EP tube, cover the EP tube, shake vigorously by hand for half a minute, incubate on ice for 10 min, and centrifuge at 1200 rpm for 15 min at 4°C.

[0024] 3) At this time, the ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Thicknessaaaaaaaaaa
Login to View More

Abstract

The invention provides an application of PBLD gene in preparation of a medicine for diagnosing renal clear cell carcinoma and predicting prognosis of same. By combining Q-PCR and immunohistochemical methods, mRNA and proteins in PBLD gene in renal clear cell carcinoma tissue and para-carcinoma tissue are detected; it is found that the PBLD is significantly under-expressed in the renal clear cell carcinoma tissue, which identifies that the PBLD, as a new specific renal cancer marker, can supply a new target point to therapy of the renal cancer.

Description

technical field [0001] The invention belongs to the field of tumor molecular biology, and specifically relates to the application of PBLD gene in the diagnosis and prediction of prognosis of renal clear cell carcinoma, and the application of PBLD as a renal cancer marker in the preparation of molecular targeted drugs. Background technique [0002] Renal cell carcinoma (RCC), referred to as renal cell carcinoma, is a malignant tumor originating from the urinary tubular epithelial system of the renal parenchyma, and is the most common malignant tumor of the renal parenchyma. Kidney cancer accounts for about 2% of all adult malignancies and is widespread worldwide, especially in developed countries where the incidence is higher than in less developed countries. Worldwide, more than 295,000 new cases of RCC are diagnosed each year, and more than 134,000 RCC patients die. In the United States, more than 63,990 people are newly diagnosed with kidney cancer each year, and more tha...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6886
CPCC12Q1/6886C12Q2600/118C12Q2600/158
Inventor 路君
Owner 路君