Supercharge Your Innovation With Domain-Expert AI Agents!

Application of P2X7 receptor in diagnosis and treatment of rheumatoid arthritis

A 1. P2X7, rheumatoid technology, applied in the field of biomedicine, can solve the problems of poor specificity and low sensitivity, and achieve the effect of overcoming low specificity, high sensitivity and accurate diagnosis

Inactive Publication Date: 2019-01-04
THE THIRD AFFILIATED HOSPITAL OF GUANGZHOU MEDICAL UNIVERSITY
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The technical problem to be solved in the present invention is to overcome the defects and deficiencies of current diagnostic markers for rheumatoid arthritis, such as poor specificity and low sensitivity, and provide a new diagnostic marker for rheumatoid arthritis, that is, P2X7 receptors

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of P2X7 receptor in diagnosis and treatment of rheumatoid arthritis
  • Application of P2X7 receptor in diagnosis and treatment of rheumatoid arthritis
  • Application of P2X7 receptor in diagnosis and treatment of rheumatoid arthritis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041]Example 1 RT-PCR detection of P2X7 receptor levels in patients with rheumatoid arthritis

[0042] 1. Experimental method

[0043] (1) Preparation of cDNA

[0044] The synovial tissues of patients with rheumatoid arthritis and bone and joint replacement were obtained from the Third Affiliated Hospital of Guangzhou Medical University and Xintang Hospital, Zengcheng District, Guangzhou. The joint synovial tissue was collected aseptically. After the operation, the joint synovial tissue was taken in a clean and sterile 50mL centrifuge tube, placed on ice, and the fat tissue, bones, blood vessels, etc. were removed on the aseptic operating table, and then washed with PBS. 3 times; RNA was extracted and cDNA was prepared by reverse transcription.

[0045] (2)PCR primers

[0046] P2X7-F (SEQ ID NO: 1): ACGTTTGCTTTGCTCTGGTG;

[0047] P2X7-R (SEQ ID NO:2): ACCTTGGTGTGCACAGAACT.

[0048] Using the prepared cDNA as a template, a real-time fluorescent PCR experiment was carried ...

Embodiment 2

[0055] Example 2 ROC curve analysis of the diagnostic value of P2X7 receptors in patients with rheumatoid arthritis

[0056] 1. Experimental method

[0057] SPSS17.0 software was used to analyze the diagnostic value of P2X7 receptor in patients with rheumatoid arthritis.

[0058] 2. Experimental results

[0059] Experimental results such as figure 2 As shown, the ROC curve analysis results show that the AUC area is 0.884, indicating that the P2X7 receptor has a good value in the diagnosis of RA; at the same time, the ROC curve analysis shows that the sensitivity and specificity of the P2X7 receptor for the diagnosis of RA are 80% and 92%, respectively. The 95% confidence interval is 0.780-0.998.

Embodiment 3

[0060] Example 3 Correlation analysis between P2X7 receptor level and serum inflammatory cytokines IL-1β, IL-6 and IL-8 in patients with rheumatoid arthritis

[0061] 1. Experimental method

[0062] The levels of inflammatory cytokines L-1β, IL-6 and IL-8 in the serum of patients with rheumatoid arthritis were detected by enzyme-linked immunosorbent assay. Fresh sera from patients with rheumatoid arthritis were collected and detected by enzyme-linked immunosorbent assay. The kit uses the product of GeneStar Company. Specific steps: prepare the standard product dilution, collect the serum of patients with rheumatoid arthritis, operate according to the instructions of the enzyme-linked immunosorbent assay kit, and finally detect the optical density (ie, OD value) with a microplate reader. According to the standard absorbance value and the corresponding concentration technical standard curve, the levels of cytokines L-1β, IL-6 and IL-8 in the serum of patients with rheumatoid a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of biomedical technology, and discloses an application of P2X7 receptor in diagnosis and treatment of rheumatoid arthritis. The P2X7 receptor is firstly identified to be abnormally high in the rheumatoid arthritis disease and is proportional to the inflammation factor level of the rheumatoid arthritis, the targeted inhibition of P2X7 receptor can inhibit the inflammatory response of the rheumatoid arthritis; therefore, the P2X7 receptor can be used for the diagnosis and treatment of rheumatoid arthritis, which overcomes the shortcomings of low specificity andinsufficient sensitivity of existing diagnostic markers of rheumatoid arthritis, which has a good diagnosis value for rheumatoid arthritis with rapid and convenient detection, high accuracy, strong specificity and high sensitivity. The accurate diagnosis of rheumatoid arthritis can be realized by applying of P2X7 receptor, which has a wide application prospect in the adjuvant diagnosis and treatment of rheumatoid arthritis in the medical industry.

Description

technical field [0001] The invention belongs to the technical field of biomedicine. More specifically, it relates to the application of P2X7 receptor as a diagnostic marker for rheumatoid arthritis and its therapeutic role in the inflammatory response of rheumatoid arthritis. Background technique [0002] Rheumatoid arthritis (Rheumatoid arthritis, RA) is an autoimmune disease, its pathological features are inflammatory response and increased secretion of inflammatory cytokines, and its clinical manifestations are long-term chronic inflammatory infiltration, joint pain, joint swelling and joint deformity. Great damage to health and life. Epidemiological studies have found that the incidence of rheumatoid arthritis in women is about 1.16% in the world, and 0.44% in men. Rheumatoid arthritis has become an urgent public health problem and a hot spot in clinical research. [0003] The pathogenesis of rheumatoid arthritis mainly includes inflammatory cytokine theory, T cell the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6883C12N15/11A61K45/00A61P19/02A61P29/00
CPCA61K45/00A61P19/02A61P29/00C12Q1/6883C12Q2600/158
Inventor 洪宏海李磊陈永和夏勇
Owner THE THIRD AFFILIATED HOSPITAL OF GUANGZHOU MEDICAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More