Duck type 3 adenovirus antibody indirect ELISA detection method and detection kit and application thereof

A detection kit, adenovirus technology, applied in the direction of virus/phage, virus, virus peptide, etc., can solve the problem that the research of virus serological detection method has not been reported, and achieve rapid detection, good specificity and repeatability. Effect

Active Publication Date: 2020-12-25
INST OF ANIMAL HUSBANDRY & VETERINARY FUJIAN ACADEMY OF AGRI SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the research on duck type 3 adenosis is mainly limited to the morphology, pathogenicity and gene sequence analysis, but there is no report on the serological detection method of the virus

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Duck type 3 adenovirus antibody indirect ELISA detection method and detection kit and application thereof
  • Duck type 3 adenovirus antibody indirect ELISA detection method and detection kit and application thereof
  • Duck type 3 adenovirus antibody indirect ELISA detection method and detection kit and application thereof

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0022] A preparation method of Fiber2 protein, using the nucleic acid of duck type 3 adenovirus as a template, using designed and synthesized specific primers to carry out PCR amplification, and reclaiming the amplified PCR product; the amplified PCR product, pET-32a expression vector First digest with EcoRI and XhoI and then ligate to construct the recombinant expression plasmid; transform the recombinant expression plasmid into Rosetta (DE3) competent cells, induce expression with isopropylthiogalactoside, and purify the obtained expression product. The Fiber2 protein is obtained;

[0023] Wherein, the sequence of the specific primer is as follows:

[0024] Upstream primer F2F:GACAC GAATTC ATGAAACGGACCAACAGATC

[0025] Downstream primer F2R:

[0026] GACAC CTCGAG CTAATTAACATTTGATGGGTTGCTAACGTACG. Wherein, the sequences of the underlined parts in the upstream and downstream primers are respectively EcoRI and XhoI restriction enzyme cutting sites.

[0027] The amino aci...

Embodiment 1

[0046] Example 1: Preparation of Fiber2 protein:

[0047] 1. Materials:

[0048] 1.1 Experimental reagents and consumables:

[0049] The PCR amplification kit Phanta Max Super-Fidelity DNA Polymerase was purchased from Nanjing Nuoweizan Biotechnology Co., Ltd.; the viral nucleic acid extraction kit EasyPure Viral DNA / RNA Kit, DH5a competent strains, and Rosetta (DE3) competent strains were purchased from Beijing Quanshijin Biotechnology Co., Ltd.; EcoRI, XhoI restriction endonuclease and ligase T4DNAligase were purchased from Thermo Scientific; pET-32a expression vector was purchased from Takara; goat anti-duck IgG enzyme-labeled secondary antibody was purchased from KPL; TMB chromogenic reagent was purchased from Boster Biotechnology Co., Ltd.; other conventional reagents and consumables were purchased from Sangon Bioengineering (Shanghai) Co., Ltd.

[0050] 1.2 Virus strains and serum:

[0051] Duck Adenovirus Type 3 (DAdV-3), Duck Plague Virus (DPV), Duck Parvovirus (MDP...

Embodiment 2

[0087] Example 2: Indirect ELISA detection of duck type 3 adenovirus antibody

[0088] 3. ELISA method establishment

[0089] (1) Coating: the purified Fiber2 protein was used as the coating antigen, and the Fiber2 protein was diluted with 0.05M, pH9.6 carbonate buffer solution and added to a 96-well ELISA plastic well plate, 100 μL per well, in 4 Coat overnight at ℃; discard the excess antigen in the coated wells, add 200 μL of PBST to each well to wash 4 times, and pat the plate dry after washing;

[0090] (2) Blocking: add 200 μL of 5% skim milk to each well, block at 37°C for 2 hours; discard the excess skim milk in the blocked wells, wash 4 times with PBST, and pat dry after washing;

[0091] (3) Add the serum to be tested: add 100 μL of duck serum diluted with PBS buffer to each well, and incubate at 37° C. for 1 hour. Discard excess duck serum in wells after incubation, wash 4 times with PBST, and pat dry after washing;

[0092] (4) Add secondary antibody: add 100 μL...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to an indirect ELISA detection method and kit for a duck adenovirus type 3 antibody and application thereof. The method comprises that steps of coating an enzyme-labeled plate with Fiber2 protein as a coating antigen, incubating a serum sample to be tested with an enzyme-labeled plate after dilution, adding an enzyme-labeled second antibody, incubating and coloring, and measuring the OD value of the reacted serum sample; As that indirect ELISA detection method established by using Fiber2 protein as coat antigen, the duck type 3 adenovirus antibody can be directly detected, and specificity and repeatability are good. The results showed that this method could be used as a method for detection of duck adenovirus type 3 antibody.

Description

technical field [0001] The invention relates to an indirect ELISA detection method for duck type 3 adenovirus antibody, a detection kit and application thereof. Background technique [0002] At present, according to the classification of the International Committee on Taxonomy of Viruses (ICTV), the duck-derived adenoviruses that have been clearly classified include duck adenovirus A (Duck atadenovirus A, DAdV-A) and duck adenovirus B (Duck aviadenovirus B, DAdV-B). ). Duck adenovirus type A, also known as egg drop syndrome virus (Egg drop syndrome virus, EDSV), was first reported in the Netherlands in 1976, and the clinical manifestations of infected ducks were respiratory symptoms. Duck adenovirus type B, also known as duck adenovirus type 2 (Duck adenovirus 2, DAdV-2), was first reported in France in 1982. The clinical manifestations of ducks infected with this virus were emaciation and lameness. [0003] Duck adenovirus 3 (DAdV-3) is a new type of duck adenovirus that ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/70C07K14/075G01N33/68
CPCC07K14/005C12N15/70C12N2710/10222G01N33/6854G01N2333/075
Inventor 陈翠腾万春和黄瑜施少华陈珍程龙飞傅光华
Owner INST OF ANIMAL HUSBANDRY & VETERINARY FUJIAN ACADEMY OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap